NOWINY LEKARSKIE DWUMIESIĘCZNIK NAUKOWY UNIWERSYTETU MEDYCZNEGO IM. KAROLA MARCINKOWSKIEGO W POZNANIU MEDICAL NEWS

March 21, 2018 | Author: Franciszek Szewczyk | Category: N/A
Share Embed Donate


Short Description

1 NOWINY LEKARSKIE DWUMIESIĘCZNIK NAUKOWY UNIWERSYTETU MEDYCZNEGO IM. KAROLA MARCINKOWSKIEGO W POZNANIU MEDICAL NEWS A B...

Description

NOWINY LEKARSKIE DWUMIESIĘCZNIK NAUKOWY UNIWERSYTETU MEDYCZNEGO IM. KAROLA MARCINKOWSKIEGO W POZNANIU

MEDICAL NEWS A BIMONTHLY SCIENTIFIC JOURNAL PUBLISHED BY POZNAN UNIVERSITY OF MEDICAL SCIENCES POLAND

Rok założenia Founded in

1889

4 2011 (80)

ISSN 0860-7397

Indeksowane w/Indexed in: Polska Bibliografia Lekarska, MNiSW Pełne teksty prac/Full texts on line: http://www.nowinylekarskie.ump.edu.pl

REDAKTOR NACZELNY EDITOR IN CHIEF prof. dr hab. Marian Grzymisławski SEKRETARZ REDAKCJI EDITORIAL SECRETARY mgr Danuta Węglewska SEKRETARIAT SECRETARY mgr Grażyna Dromirecka dr med. Włodzimierz Szczepaniak mgr Danuta Węglewska KOMITET REDAKCYJNY EDITORIAL BOARD prof. dr hab. Maria Borysewicz-Lewicka (Poznań) prof. dr hab. Grzegorz H. Bręborowicz (Poznań) prof. dr hab. Magdalena Czarnecka-Operacz (Poznań) prof. dr hab. Mieczysława Czerwionka-Szaflarska (Bydgoszcz) prof. Wolfgang Dick (Mainz – Niemcy) prof. dr hab. Leon Drobnik (Poznań) prof. dr hab. Janusz Gadzinowski (Poznań) prof. dr hab. Wojciech Golusiński (Poznań) prof. dr hab. Witold Jurczyk (Poznań) prof. dr hab. Jacek Juszczyk (Poznań) prof. dr hab. Ryszard Koczorowski (Poznań) prof. UM dr hab. Tomasz Kościński (Poznań) prof. Odded Langer (Nowy Jork – USA) prof. dr hab. Krzysztof Linke (Poznań) prof. Tadeusz Maliński (Athens – USA) prof. UM dr hab. Roman K. Meissner (Poznań) prof. dr hab. Michał Musielak (Poznań) prof. dr hab. Leszek Paradowski (Wrocław) mgr Aniela Piotrowicz (Poznań) mgr Bogdan Poniedziałek (Poznań) prof. dr hab. dr h.c. Antoni Pruszewicz (Poznań) prof. dr hab. Kazimierz Rzymski (Poznań) prof. dr hab. Krzysztof Słowiński (Poznań) prof. dr hab. Bruno Szczygieł (Warszawa) prof. dr hab. Andrzej Szkaradkiewicz (Poznań) prof. UM dr hab. med. Jacek Szmeja (Poznań) prof. dr hab. Roman Szulc (Poznań) prof. Kai Taeger (Regensburg – Niemcy) prof. dr hab. Krzysztof Wiktorowicz (Poznań) prof. dr hab. Witold Woźniak (Poznań)

WYDAWCA PUBLISHER Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu © Copyright by Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu

ADRES (ADDRESS): Katedra i Klinika Chorób Wewnętrznych, Metabolicznych i Dietetyki ul. Przybyszewskiego 49 60-355 Poznań tel./fax (61) 869-13-14 http://www.nowinylekarskie.ump.edu.pl ISSN 0860-7397

Korekta: Magdalena Knapowska-Niziolek Korekta tekstów w j. ang.: Jan Jaroszewski Skład i łamanie: Barbara Guździoł Prenumeratę „Nowin Lekarskich” prowadzi gł. specjalista ds. promocji wydawnictw uczelnianych mgr Bogumiła Strzelczak – Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu, ul. Dąbrowskiego 79, tel./fax (61) 854-72-02. Czasopismo do nabycia w Punkcie Sprzedaży Wydawnictw Naukowych – ul. Przybyszewskiego 37a. Redakcja deklaruje, że wersja papierowa „Nowin Lekarskich” jest wersją pierwotną (referencyjną). WYDAWNICTWO NAUKOWE UNIWERSYTETU MEDYCZNEGO IM. KAROLA MARCINKOWSKIEGO W POZNANIU

60-812 Poznań, ul. Bukowska 70 tel./fax (61) 854-71-51 Ark. wyd. 9,0. Ark. druk. 9,5. Papier kreda 115 g/m2, 64 x 90. Zam. nr 184/12

SPIS TREŚCI (CONTENTS)

Prace oryginalne (Original papers) Joanna Foremska-Iciek, Danuta Pupek-Musialik: Ocena zależności między stężeniami wybranych adipokin, parametrami biochemicznymi i antropometrycznymi a przesączaniem kłębuszkowym u chorych z zespołem metabolicznym (The assessment of correlations between selected adipokines concentrations, biochemical and anthropometric parameters and glomerular filtration in patients with metabolic syndrome) ......................................................

241

Katarzyna Plagens-Rotman, Grażyna Bączyk, Sławomira Kubiak, Dorota Bernad, Monika Pyszczorska, Renata Przybylska: Krwawienia wewnątrzczaszkowe u noworodków z ekstremalnie małą urodzeniową masą ciała (Intracranial hemorrhages in the extremely low birth weight infants) ................

250

Paweł Sacha, Piotr Wieczorek, Dominika Ojdana, Sławomir Czaban, Dorota Olszańska, Elżbieta Tryniszewska: Oporność szczepów Pseudomonas aeruginosa na karbapenemy po inkubacji z subinhibicyjnymi stężeniami imipenemu i meropenemu (Resistance of Pseudomonas aeruginosa to carbapenems after incubation with subinhibitory concentrations of imipenem and meropenem) ............ Magdalena Magierska-Krzysztoń, Małgorzata Posłuszna: Rozwój mowy i języka u dzieci zaimplantowanych przed trzecim rokiem życia (The development of speech and language of children with cochlear implants introduced before third year of life) ............................................................

Bartosz Frycz, Alicja Pinczewska, Paweł P. Jagodziński: Maślan sodu obniża ekspresję dehydrogenazy 17 beta-hydroksysteroidowej typu 1-szego w linii komórkowej raka gruczołu krokowego LNCaP (Sodium butyrate decreases 17 beta-hydroxysteroid dehydrogenase type 1 expression in LNCaP prostate cancer cell line) ......................................

283

Katarzyna Kaźmierczak, Marian Majchrzycki, Wanda Stryła: Rozkład zaleconych zabiegów w rehabilitacji pacjentów po urazie czaszkowo-mózgowym w zależności od stopnia urazu wg Glasgow Coma Scale (Schedule of recommended procedures in the rehabilitation of patients after TBI in respect to the level of trauma according to Glasgow Coma Scale) ..

288

Prace poglądowe (Review papers)

258

266

Izabela Rzymska, Michał Musielak: Ocena zmienności wiodących systemów wartości wśród studentów kierunku położnictwo na przestrzeni studiów licencjackich (Evaluation of changes in moral preferences among midwifery students during university studies) ..................................................................

272

Krystyna Kurowska, Anna Zuza-Witkowska: Empatia a wypalenie zawodowe u pielęgniarek onkologicznych (Empathy and occupational burnout of oncological nurses) ................................................

277

Aleksandra Bruś-Chojnicka, Andrzej Marszałek, Magdalena Moskalik, Arleta Kowala-Piaskowska, Iwona Mozer-Lisewska: Problemy związane z zakażeniem wirusem HBV w kontekście prokreacji i życia seksualnego kobiet (The issue of HBV infected women associated with procreation and sexual life) ............................................................

295

Barbara Kuczyńska, Agnieszka Wasilewska, Maciej Biczysko, Tomasz Banasiewicz, Michał Drews: Krótkołańcuchowe kwasy tłuszczowe – mechanizmy działania, potencjalne zastosowania kliniczne oraz zalecenia dietetyczne (Short chain fatty acids – mechanisms of action, potential clinical indications and nutritional indications) .........................

299

Emilia Mikołajewska: Obiektywizacja wyników rehabilitacji – próba ujęcia kompleksowego (Objectivization of rehabilitation outcomes – attempt of a complex approach) ........................................

305

Nowiny Lekarskie 2011, 80, 4, 241–249

JOANNA FOREMSKA-ICIEK, DANUTA PUPEK-MUSIALIK

OCENA ZALEŻNOŚCI MIĘDZY STĘŻENIAMI WYBRANYCH ADIPOKIN, PARAMETRAMI BIOCHEMICZNYMI I ANTROPOMETRYCZNYMI A PRZESĄCZANIEM KŁĘBUSZKOWYM U CHORYCH Z ZESPOŁEM METABOLICZNYM THE ASSESSMENT OF CORRELATIONS BETWEEN SELECTED ADIPOKINES CONCENTRATIONS, BIOCHEMICAL AND ANTHROPOMETRIC PARAMETERS AND GLOMERULAR FILTRATION IN PATIENTS WITH METABOLIC SYNDROME Katedra i Klinika Chorób Wewnętrznych, Zaburzeń Metabolicznych i Nadciśnienia Tętniczego Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Kierownik: prof. dr hab. med. Danuta Pupek-Musialik

Streszczenie Wstęp. Na świecie obserwuje się rosnącą liczbę chorych z zespołem metabolicznym, który istotnie zwiększa ryzyko rozwoju przewlekłej choroby nerek. W patogenezie uszkodzenia kłębuszków nerkowych w tej grupie chorych bierze się pod uwagę wpływ adipokin, biologicznie czynnych substancji produkowanych przez komórki tkanki tłuszczowej. Cel. Celem pracy była ocena zależności między stężeniami adiponektyny, leptyny i wisfatyny oraz wybranymi parametrami biochemicznymi i antropometrycznymi a przesączaniem kłebuszkowymu chorych z zespołem metabolicznym. Materiał i metody. Do badania zakwalifikowano 40 pacjentów, których podzielono na 2 grupy: 1 – z zespołem metabolicznym (n = 25), 2 – kontrolna (n = 15). U badanych dokonano pomiarów antropometrycznych, wartości ciśnienia tętniczego i częstości pracy serca oraz oceniono parametry biochemiczne. Oznaczono we krwi stężenia leptyny i adiponektyny (metodą radioimmunometryczną) oraz wisfatyny (metodą immunoenzymatyczną). Ponadto określono wskaźnik filtracji kłębuszkowej (eGFR) w oparciu o wzór MDRD oraz wskaźnik insulinooporności (HOMA-IR). Wyniki. U chorych z zespołem metabolicznym stwierdzono istotnie wyższe stężenia kreatyniny (77,96 ± 13,67 vs. 62,20 ± 11,51 μmol/l) i stężenia leptyny (22,85 ± 10,14 vs. 7,37 ± 4,03 ng/ml) oraz niższe wartości eGFR (84,80 ± 12,38 vs. 103,33 ± 22,62 ml/min/1,73 m2) i stężenia adiponektyny (10,90 ± 5,67vs. 14,49 ± 7,06 μg/ml) we krwi w porównaniu z grupą 2. W grupie 1 wykazano istotną ujemną korelację pomiędzy eGFR a stężeniami leptyny (r = -0,488, p < 0,05). Pozostałe badane zależności nie osiągnęły istotności statystycznej. Wnioski. Istotnie wyższe stężenia kreatyniny we krwi oraz niższe wartości eGFR u chorych z zespołem metabolicznym przemawiają za jego uszkadzającym wpływem na czynność nerek. Ujemna zależność między stężeniami leptyny a eGFR może świadczyć o udziale tej adipokiny w patogenezie uszkodzenia nerek w przebiegu zespołu metabolicznego. SŁOWA KLUCZOWE: zespół metaboliczny, przewlekła choroba nerek, przesączanie kłębuszkowe, leptyna, adiponektyna, wisfatyna.

Summary Introduction. The increasing occurence of metabolic syndrome in humans, which affects the risk for chronic kidney disease, is worldwide being observed. The adipokines, biologically active products of adipose tissue are considered as pathogenic factors leading to glomerular dysfunction. Aim. The aim of the study was to assess the link between adiponectin, leptin, visfatin serum concentration, selected biochemical and anthropometric parameters and glomerular filtration in metabolic syndrome subjects. Material and methods. 40 subjects were qualified and divided into 2 subgroups: 1 – metabolic syndrome group (n = 25), 2 – control group (n = 15). Blood pressure, heart rate, selected biochemical and anthropometric parameters were measured. Blood leptin, adiponectin (radioimmunoassay), visfatin (immunoassay) concentrations and also glomerular filtration rate (eGFR, MDRD calculated) and insulin-resistance (HOMA-IR) were estimated. Results. Metabolic syndrome subjects were characterized by significantly higher blood creatinine (77.96 ± 13.67 vs. 62.20 ± 11.51 μmol/l), leptin (22.85 ± 10.14 vs. 7.37 ± 4.03 ng/ml), lower eGFR (84.80 ± 12.38 vs. 103.33 ± 22.62 ml/min/1.73 m2) and lower blood adiponectin (10.90 ± 5.67 vs. 14.49 ± 7.06 μg/ml) levels as compared to controls. A significant negative correlation between eGFR and blood leptin (r = -0.488, p < 0.05) in study group was found. No other correlations were discovered. Conclusions. Significantly higher blood creatinine and lower eGFR in study may indicate that metabolic syndrome affects renal function. Negative correlation between blood leptin and eGFR may indicate its contribution to renal failure in the course of metabolic syndrome. KEY WORDS: metabolic syndrome, chronic kidney disease, glomerular filtration, leptin, adiponectin, visfatin.

Wstęp W ostatnich kilkunastu latach obserwuje się stale rosnącą liczbę chorych z rozpoznanym zespołem metabolicznym (Metabolic Syndrome, MS) stanowiącym kom-

pleks powiązanych ze sobą i oddziaływujących wzajemnie nieprawidłowości, takich jak: otyłość brzuszna, podwyższone wartości ciśnienia tętniczego, zaburzenia gospodarki węglowodanowej i lipidowej. Szacuje się, iż w Stanach Zjednoczonych problem dotyczy 24% dorosłych osób [1].

PRACE ORYGINALNE

242

Joanna Foremska-Iciek, Danuta Pupek-Musialik

Europejska Grupa ds. Badania Insulinooporności (EGIR) oceniła częstość występowania MS w Europie na 7–36% u mężczyzn i 5–22% u kobiet w przedziale wiekowym 40–55 lat [2]. Polskie badanie WOBASZ wykazało, że kryteria MS spełnia 19,5% mężczyzn i 18,6% kobiet (według kryteriów NCEP – ATP III) lub 20% kobiet i 23% mężczyzn (według kryteriów IDF) [3]. Wykazano, że występowanie MS wiąże się z dwukrotnie większym ryzy kiem rozwoju chorób układu sercowo-naczyniowego oraz ponad trzykrotnie większym ryzykiem zgonu z powodu tych chorób [4, 5]. Stwierdzono, że MS jest również silnym i niezależnym czynnikiem ryzyka przewlekłej choroby nerek (Chronic Kidney Disease, CKD), co wiąże się z synergistycznym, uszkadzającym działaniem wszystkich jego elementów [6]. Wykazano, że wraz ze wzrostem liczby elementów MS wzrasta stopień uszkodzenia nerek oceniany pomiarem mikroalbuminurii i wskaźnikiem filtracji kłębuszkowej [7]. Stwierdzono również, że otyłość stanowiąca kluczowy element zespołu znacząco zwiększa ryzyko rozwoju CKD, choć patomechanizmy tego działania nie są w pełni poznane [8, 9, 10]. Dowiedziono, że u osób otyłych wśród czynników partycypujących w patogenezie uszkodzenia nerek, obok insulinooporności, hiperaldosteronizmu, hiperstymulacji receptorów mineralokortykoidowych przez GTP-azę Rac-1 lub kortyzol, istotną rolę odgrywać mogą zaburzenia w stężeniach adipocytokin [11, 12, 13, 14]. Celem prezentowanej pracy była ocena zależności między stężeniami adiponektyny, leptyny i wisfatyny oraz wybranymi parametrami biochemicznymi i antropometrycznymi a czynnością nerek ocenianą na podstawie wielkości przesączania kłębuszkowego (estimated Glomerular Filtration Rate, eGFR) u chorych z MS oraz w grupie kontrolnej. Materiał i metody Do badania włączono 40 pacjentów, których podzielono na 2 grupy. Do pierwszej grupy badanej włączono 25 pacjentów (10 kobiet i 15 mężczyzn, średnia wieku 48,4 ± 8,8 lat) spełniających kryteria MS z wyłączeniem cukrzycy. Chorzy włączeni do badania dotychczas nie stosowali przewlekłej terapii hipotensyjnej oraz nie byli leczeni przewlekle lekami hipolipemizującymi lub wspomniane leki zostały odstawione na co najmniej 5 dni w przypadku leków hipotensyjnych i na co najmniej 7 dni w przypadku stosowania statyn lub fibratów. Liczebność grup determinowały trudności w rekrutacji chorych (większość z planowanych do badania chorych nie zgodziła się na odstawienie leków hipotensyjnych). Chorych rekrutowano w oparciu o kryteria IDF (International Diabetes Federation) z 2005 roku, zakładające jako niezbędną obecność otyłości brzusznej (obwód tali ≥ 94 cm dla mężczyzn i ≥ 80 cm dla kobiet) oraz współistnienie co najmniej 2 z 4 poniższych kryteriów: 1. Triglicerydy ≥ 150 mg/dl lub leczenie dyslipidemii;

PRACE ORYGINALNE

2. HDL cholesterol < 40 mg/dl (mężczyźni), < 50 mg/dl (kobiety) lub leczenie dyslipidemii; 3. Ciśnienie tętnicze ≥ 130/85 mmHg lub leczenie nadciśnienia tętniczego; 4. Glikemia na czczo ≥ 100 mg/dl lub leczenie cukrzycy typu 2 [15]. Drugą grupę stanowiło 15 zdrowych osób, porównywalnych pod względem wieku z badaną grupą (10 kobiet i 5 mężczyzn, średni wiek 45,8 ± 8,6 lat). Kryteria wyłączenia stanowiły: wtórna postać nadciśnienia tętniczego lub otyłości, wiek ≥ 60 lat, zaawansowana CKD (od 3 stadium zaawansowania, z eGFR < 60 ml/min/1,73 m2), choroba nowotworowa, choroby układowe, cukrzyca, zaburzenia endokrynologiczne mogące mieć wpływ na przebieg badania, zaburzenia elektrolitowe, niewydolność serca skurczowa i/lub rozkurczowa, niewydolność wątroby, choroby psychiczne, nadmierne spożycie alkoholu, ostry lub przewlekły proces zapalny bez względu na lokalizację. We wszystkich grupach przeprowadzono badanie podmiotowe, przedmiotowe, w tym pomiary antropometryczne: wzrost, masę ciała, obwód talii. Obliczono wskaźnik masy ciała (Body Mass Index, BMI), a także określono zawartość tkanki tłuszczowej w organizmie metodą bioimpedancji elektrycznej z wykorzystaniem aparatu Bodystat 1500 firmy Bodystat Ltd. Wyznaczono średnią częstość pracy serca oraz średnią wartość ciśnienia tętniczego zgodnie z zaleceniami Polskiego Towarzystwa Nadciśnienia Tętniczego (PTNT) z 2011 roku [16]. U wszystkich badanych oznaczono: 1. Podstawowe parametry biochemiczne (OB, CRP, kreatynina, elektrolity, triglicerydy, cholesterol całkowity i jego frakcje, glukoza i insulina) we krwi żylnej, pobranej na czczo, przy pomocy standardowych testów komercyjnych; 2. Stężenie leptyny (ng/ml) w osoczu, na czczo, metodą radioimmunometryczną, przy pomocy zestawu firmy DRG; 3. Stężenie adiponektyny (μg/ml) w osoczu, na czczo, metodą radioimmunometryczną, przy pomocy zestawu firmy DRG; 4. Stężenie wisfatyny (ng/ml) w osoczu, na czczo, metodą immunoenzymatyczną, przy pomocy zestawu firmy Alpco diagnostics. Wielkość eGFR obliczono w oparciu o wzór MDRD (Modification of Diet in Renal Diseases), na podstawie oznaczenia stężenia kreatyniny w surowicy oraz określenia wieku, płci i rasy badanych. Do określenia insulinooporności użyto wskaźnika HOMA-IR (Homeostasis Model Assessment-Insulin Resistance), który obliczono z iloczynu stężeń glukozy na czczo wyrażonej w mmol/l i insuliny na czczo wyrażonej w μU/ml dzielonego przez 22,5. Do obliczeń wykorzystano pakiet STATISTICA 10.0. Wszystkie wykazane różnice przyjęto za statystycznie istotne przy poziomie istotności p < 0,05. Na przeprowadzenie badania uzyskano zgodę Terenowej Komisji Bioetycznej przy Uniwersytecie Medycznym im. Karola Marcinkowskiego w Poznaniu.

Ocena zależności między stężeniami wybranych adipokin, parametrami biochemicznymi i antropometrycznymi …

Wyniki Porównywane grupy różniły się między sobą zarówno wartościami parametrów antropometrycznych jak i ciśnienia tętniczego, co wynika z definicji grup (Tabela 1). Istotne różnice dotyczyły także parametrów gospodarki lipidowej oraz węglowodanowej. Chorzy z MS cechowali się istotnie wyższymi stężeniami triglicerydów i glukozy oraz niższymi stężeniami HDL cholesterolu w porównaniu z osobami zdrowymi. Różnice w stężeniach cholesterolu całkowitego, LDL cholesterolu, insuliny oraz wartości HOMA-IR nie osiągnęły istotności statystycznej (Tabela 2). Ponadto u chorych z MS odnotowano istotnie wyższe stężenia kreatyniny w surowicy krwi oraz znacząco niższe wartości przesączania kłębuszkowego w stosunku do grupy kontrolnej. Analiza stężeń oznaczonych adipokin wykazała również istnienie znaczących różnic między grupami. Chorych z MS charakteryzowały istotnie niższe stężenia adiponektyny oraz istotnie wyższe stężenia leptyny w porównaniu z grupą kontrolną. Nie stwierdzono natomiast istotnych różnic w stężeniach wisfatyny pomiędzy badanymi grupami (Tabela 3). U chorych z MS wykazano obecność istotnej ujemnej korelacji między stężeniami adiponektyny a wartościami skurczowego ciśnienia tętniczego [Systolic Blood Pressure, SBP (r = -0,421, p < 0,05)], a także dodatnich zależności między stężeniami leptyny a BMI (r = 0,410, p < 0,05), stężeniami insuliny (r = 0,482, p < 0,05), insulinoopornością (r = 0,429, p < 0,05) oraz procentową zawartością tkanki tłuszczowej w organizmie (r = 0,514, p < 0,05). W omawianej grupie stwierdzono również znaczące dodatnie korelacje pomiędzy stężeniami wisfatyny a SBP (r = 0,447, p < 0,05) i wartościami rozkurczowego ciśnienia tętniczego [Diastolic Blood Pressure, DBP (r = 0,796, p < 0,05)]. Tabela 1. Wiek, parametry antropometryczne, wartości ciśnień tętniczych badanych grup (test t-Studenta dla zmiennych niepowiązanych) Table 1. Age, anthropometric parameters, blood pressure values in studied groups (t-Student test for unrelated variables) Zespół metaboliczny

Kontrola

p wartość

25

15

-

48,40 ± 8,80*

45,80 ± 8,60

> 0,05

BMI (kg/m )

35,04 ± 6,31

22,46 ± 2,59

< 0,05

Obwód talii (cm)

111,58 ± 15,21

77,13 ± 6,17

< 0,05

SBP (mmHg)

164,96 ± 10,95

129,2 ± 10,30

< 0,05

DBP (mmHg)

91,80 ± 7,98

75,66 ± 5,26

< 0,05

FAT (%)

36,39 ± 10,82

23,78 ± 4,19

< 0,05

n Wiek (lata) 2

* W tabeli podano wartości średnie oraz odchylenia standardowe (SD, standard deviation), n – liczność grupy, BMI (body mass index) – wskaźnik masy ciała, DBP (diastolic blood pressure) – średnia wartość rozkurczowego ciśnienia tętniczego, SBP (systolic blood pressure) – średnia wartość skurczowego ciśnienia tętniczego, FAT (%) – procentowa zawartość tkanki tłuszczowej w organizmie.

243

Tabela 2. Parametry biochemiczne badanych grup (test t-Studenta dla zmiennych niepowiązanych) Table 2. Biochemical parameters in studied groups (t-Student test for unrelated variables) Zespół metaboliczny

Kontrola

Kreatynina (μmol/l) 77,96 ± 13,67* 62,20 ± 11,51

p wartość < 0,05

eGFR (ml/min/1,73 m2) 84,80 ± 12,38 103,33 ± 22,62 < 0,05 Glukoza (mmol/l) Insulina (μU/ml)

5,56 ± 0,68

4,90 ± 0,33

< 0,05

16,06 ± 10,53 13,85 ± 3,41

> 0,05

HOMA-IR

3,99 ± 2,53

3,02 ± 0,84

> 0,05

TChol (mmol/l)

5,47 ±1,01

4,68 ± 1,00

> 0,05

LDLChol (mmol/l)

3,28 ± 0,61

2,89 ± 0,86

> 0,05

HDLChol (mmol/l)

1,18 ± 0,27

1,36 ± 0,33

< 0,05

TG (mmol/l)

2,43 ± 1,78

0,91 ± 0,61

< 0,05

*W tabeli podano wartości średnie oraz odchylenia standardowe (SD, standard deviation), eGFR (estimated glomerular filtration rate) – wartość przesączenia kłębuszkowego, HOMA-IR (Homeostasis Model Assessment-Insulin Resistance) – wskaźnik insulinooporności, Tchol (total cholesterol) – cholesterol całkowity, HDLChol (high-density lipoproteins cholesterol) – cholesterol frakcji HDL, LDLChol (lowdensity lipoproteins cholesterol) – cholesterol frakcji LDL, TG (triglycerides) – triglicerydy.

Tabela 3. Stężenia adiponektyny, leptyny i wisfatyny w badanych grupach (test t-Studenta dla zmiennych niepowiązanych) Table 3. Adiponectin, leptin and visfatin concentrations in studied groups (t-Student test for unrelated variables) Zespół metaboliczny

Kontrola

p wartość

Wisfatyna (ng/ml)

1,42 ± 1,36* 1,50 ± 1,61

Adiponektyna (μg/ml)

10,90 ± 5,67 14,49 ± 7,06 < 0,05

Leptyna (ng/ml)

22,85 ± 10,14 7,37 ± 4,03 < 0,05

> 0,05

*W tabeli podano wartości średnie oraz odchylenia standardowe (SD, standard deviation).

Analizując zależności między parametrami antropometrycznymi, biochemicznymi i wartościami ciśnienia tętniczego a wartościami eGFR wykazano istnienie tylko jednej istotnej statystycznie ujemnej korelacji w grupie badanej pomiędzy wspomnianą wartością przesączania kłębuszkowego a stężeniami leptyny (Tabela 4 i 5, Wykres 1).

PRACE ORYGINALNE

244

Joanna Foremska-Iciek, Danuta Pupek-Musialik

Tabela 4. Korelacje między wartością eGFR a badanymi adipokinami Table 4. Correlations between eGFR and investigated adipokines e GFR vs adipokiny Grupa badana (n = 25)

Parametr

rP/rS Leptyna (ng/ml) Adiponektyna (μg/ml) Wisfatyna (ng/ml)

Grupa kontrolna (n = 15)

p

rP/rS

p

rP = -0,488 < 0,05 rP = -0,291 > 0,05 rS = -0,207 > 0,05

rS = 0,046

> 0,05

rS = 0,051 > 0,05

rS = 0,165

> 0,05

rP – współczynnik korelacji Pearsona (Pearson coefficient), RS – współczynnik korelacji Spearmana (Spearman coefficient).

Tabela 5. Korelacje między wartościami eGFR a badanymi parametrami biochemicznymi i antropometrycznymi Table 5. Correlations between eGFR and investigated biochemical and anthropometric parameters

Parametr

eGFR vs parametry biochemiczne i antropometryczne Grupa badana Grupa kontrolna (n = 25) (n = 15) rP/rS

p

rP/rS

p

DBP (mmHg)

rS = 0,020 > 0,05 rS = 0,317 > 0,05

SBP (mmHg)

rP = -0,023 > 0,05 rS = 0,217 > 0,05

Obwód talii (cm)

rS = -0,192 > 0,05 rP = -0,041 > 0,05

BMI (kg/m2)

rS = -0,144 > 0,05 rS = -0,514 > 0,05

FAT (%)

rP = -0,260 > 0,05 rP = -0,428 > 0,05

TChol (mmol/l)

rS = 0,126 > 0,05 rP = -0,526 > 0,05

LDLChol (mmol/l)

rP = -0,036 > 0,05 rP = -0,545 > 0,05

HDLChol (mmol/l)

rP = 0,058 > 0,05 rP = -0,327 > 0,05

TG (mmol/l)

rS = 0,101 > 0,05 rS = -0,311 > 0,05

Glukoza (mmol/l)

rP = 0,223 > 0,05 rP = 0,003 > 0,05

Insulina (μIU/ml)

rS = -0,308 > 0,05 rP = -0,501 > 0,05

HOMA-IR

rS = -0,245 > 0,05 rP = -0,504 > 0,05

rP – współczynnik korelacji Pearsona (Pearson coefficient), rS – współczynnik korelacji Spearmana (Spearman coefficient); eGFR (estimated glomerular filtration rate) – wartość przesączenia kłębuszkowego, BMI (body mass index) – wskaźnik masy ciała, DBP (diastolic blood pressure)średnia wartość rozkurczowego ciśnienia tętniczego, SBP (systolic blood pressure) – średnia wartość skurczowego ciśnienia tętniczego, FAT (%) – procentowa zawartość tkanki tłuszczowej w organizmie, HOMA-IR (Homeostasis Model Assessment-Insulin Resistance) – wskaźnik insulinooporności, TChol (total cholesterol) – cholesterol całkowity, HDLChol (highdensity lipoproteins cholesterol) – cholesterol frakcji HDL, LDLChol (lowdensity lipoproteins cholesterol) – cholesterol frakcji LDL, TG (triglycerides) – triglicerydy.

PRACE ORYGINALNE

Wykres 1. Ujemna zależność między przesączaniem kłębuszkowym (eGFR) a stężeniami leptyny u chorych z zespołem metabolicznym (rPearsona = -0,488, p < 0,05). Graph 1. Negative correlation between eGFR and leptin concentration in metabolic syndrome subjects (Pearson coefficient = -0.488, p < 0.05).

Dyskusja Przedmiotem licznych badań ostatnich lat stała się ocena uszkadzającego wpływu MS i/lub poszczególnych jego składowych na funkcję nerek. W 2011 roku, po przeanalizowaniu 11 badań obejmujących łącznie 30146 badanych, Thomas i wsp. stwierdzili istnienie znaczącego związku między występowaniem MS a postępującą redukcją eGFR do wartości poniżej 60 ml/min/1,73 m2 (OR1.55; 95% CI: 1.34-1.80), a także występowaniem mikroalbuminurii i jawnego białkomoczu. Siła tej zależności wzrastała wraz z liczbą składowych zespołu. Dla każdej z nich określono różny wpływ na ryzyko spadku eGFR poniżej 60 ml/min/ 1,73 m2, odpowiednio – dla podwyższonych wartości ciśnienia tętniczego – OR 1.61 (95% CI 1.29-2.01), dla hipertriglicerydemii – OR 1.27 (95% CI 1.11-1.46), dla obniżonego stężenia HDL cholesterolu-OR 1.23 (95% CI 1.121.36), dla otyłości brzusznej – OR 1.19 (95% CI 1.05-1.34), dla hiperglikemii – OR 1.14 (1.03-1.26) [17]. Po zbadaniu 6217 chorych z CKD definiowaną jako wartość eGFR < 60 mL/min/1,73 m2 oraz 6125 chorych z mikroalbuminurią Chen i wsp. stwierdzili znacząco częstsze występowanie tych patologii u chorych z MS w porównaniu z osobami bez tego zespołu [OR 2.60 (95% CI, 1.68 to 4.03) dla eGFR i OR 1.89 (CI, 1.34 to 2.67) dla mikroalbuminurii]. Podobnie jak w przytoczonym wcześniej badaniu, częstość ta wzrastała wraz z ilością składowych zespołu. W porównaniu z chorymi bez MS lub mającymi tylko jedną z jego komponent, iloraz szans rozwoju CKD chorych z 2, 3, 4 i 5 składowymi MS wyniósł odpowiednio: 2.21 (95% CI, 1.16 to 4.24), 3.38 (95% CI, 1.48 to 7.69), 4.23 (95% CI, 2.06 to 8.63) i 5.85 (95% CI, 3.11 to 11.0) [7]. W przeciwieństwie do cytowanych prac Gatti i wsp. stwierdzili w grupie 380 otyłych osób bez cukrzycy, że ryzyko CKD (eGFR < 60 ml/ min/1,73 m2) jest niezależne od obecności MS i powiązanych z nim nieprawidłowości [18]. Z kolei istnienie związku między występowaniem MS a redukcją eGFR znalazło potwierdzenie między innymi w pracach zespołów Kawa-

Ocena zależności między stężeniami wybranych adipokin, parametrami biochemicznymi i antropometrycznymi …

moto, Johns’a i Okpechi’ego [19, 20, 21]. W niniejszym badaniu stwierdzono, że chorych z MS charakteryzowały istotnie wyższe stężenia kreatyniny w surowicy krwi oraz znacząco niższe wartości eGFR w porównaniu z osobami zdrowymi. Zależność ta okazała się istotna mimo wczesnego stadium uszkodzenia nerek (eGFR ≥ 60 ml/min/1,73 m2). Wynik ten nawiązuje do wcześniej przytoczonych prac oraz publikacji Landecho i wsp., którzy dowiedli, że wszystkie składowe MS z wyjątkiem obniżonego stężenia HDL cholesterolu wiążą się istotnie ze zwiększonym ryzykiem wystąpienia wczesnych etapów CKD (eGFR > 60 ml/min/ 1,73 m2) [22]. Wśród czynników patogenetycznych uszkodzenia nerek w przebiegu MS bierze się pod uwagę, obok poszczególnych składowych zespołu, tj. otyłości brzusznej, podwyższonych wartości ciśnienia tętniczego, hiperglikemii i zaburzeń lipidowych, także hiperinsulinemię i insulinooporność. Jednakże dane z piśmiennictwa są niejednoznaczne. W niektórych badaniach wykazano istotny związek między wartościami BMI a eGFR, inne nie potwierdziły istnienia takiej zależności. Henegar z zespołem w badaniu eksperymentalnym u psów stwierdził, że otyłość wyindukowana dietą wysokotłuszczową prowadzi do wzrostu wartości ciśnienia tętniczego, hiperinsulinemii, zwiększenia aktywności reninowej osocza oraz hiperfiltracji kłębuszkowej i pojawienia się zmian strukturalnych w kłębuszkach nerkowych [23]. Zależności te znalazły potwierdzenie w badaniach klinicznych u ludzi [24, 25]. Analizując czynniki ryzyka progresji wczesnych stadiów CKD Yoshida i wsp. ocenili, że osoby z najwyższymi wartościami BMI cechowały się istotnie większą wartością eGFR w porównaniu z osobami o niższych poziomach tego wskaźnika, zaś do wspomnianych czynników postępu choroby zaliczyli białkomocz, palenie tytoniu, nadciśnienie tętnicze i niskie stężenie HDL cholesterolu [26]. Z kolei Kawamoto i wsp. zaobserwowali, że wzrostowi wartości BMI począwszy od 22,0 kg/m2 towarzyszy spadek wartości eGFR i stwierdzili, że BMI jest jednym ze znaczących i niezależnych czynników wpływających na przesączanie kłębuszkowe [27]. Zwrócono również uwagę na istnienie ujemnych korelacji między wartościami eGFR a BMI, DBP, stężeniem glukozy na czczo oraz dodatnich zależności z poziomami HDL cholesterolu, leczeniem hipotensyjnym i hipolipemizującym [19]. Oceniając wpływ otyłości na roczną progresję zaawansowanej CKD (eGFR < 60 ml/min/1,73 m2) Othman i wsp. dowiedli, że wyjściowa wartość BMI oraz młody wiek chorych są silnie i niezależnie związane z szybszym postępem choroby wynikającym z istotnej redukcji eGFR tych chorych [28]. Burton z zespołem stwierdzili, że na występowanie CKD ma istotny wpływ nie tylko wzrost wartości BMI, lecz także zwiększenie obwodu talii będące wykładnikiem otyłości brzusznej. Takiego związku nie wykazali w stosunku do wskaźnika talia-biodro (Waist to Hip Ratio,WHR) [29]. Z kolei Kansui i wsp. wykazali obecność ujemnej korelacji między wartościami eGFR a BMI, wiekiem, SBP i hemoglobiną glikowaną badanych [30]. W niniejszej pracy nie stwierdzono istotnych zależności między ocenianymi parametrami antropometrycznymi (BMI, obwód talii, procen-

245

towa zawartość tkanki tłuszczowej w organizmie) a eGFR badanej populacji. Nie wykazano również istotnego związku między eGFR a parametrami biochemicznymi, stężeniem insuliny, insulinoopornością oraz wartościami ciśnienia tętniczego. Możliwe, że na uzyskane wyniki miała wpływ mała liczebność grupy, jednakże otrzymane rezultaty nawiązują do pracy Hobbs i wsp., którzy analizując dużo większą populację 61637 osób, stwierdzili brak zależności między wartością eGFR a wskaźnikiem BMI [31]. Brak korelacji między insulinoopornością a eGFR wykazali Gatti i wsp. a także Johns i wsp., którzy dodatkowo stwierdzili, że tylko podwyższone wartości ciśnienia tętniczego spośród wszystkich składowych MS wiążą się z występowaniem CKD [18, 20]. Z kolei Brown z zespołem analizując wpływ masy ciała na progresję CKD wyrażoną postępującą redukcją eGFR (∆ eGFR) u 499 dorosłych rasy białej wykazali, że zarówno w grupie chorych z otyłością jak i bez, niezależnie od stadiów choroby nerek (3 vs 4 vs 5) nie ma związku między BMI a ∆ eGFR [32]. Podobne wnioski wysunęli Khedr i wsp. [33]. Obermayr i wsp. sugerowali nawet, że otyłym pacjentom z CKD w stadium jawnego białkomoczu nie należy zalecać zmniejszenia masy ciała z uwagi na związek wysokich wartości wskaźnika BMI z redukcją śmiertelności w tej grupie chorych [34]. Badania ostatnich lat dostarczyły dowodów na udział adipokin, biologicznie czynnych substancji wydzielanych przez adipocyty, w procesie uszkodzenia nerek u chorych z MS. Jednym z nich jest adiponektyna, białko 30 kDa, kodowane przez gen APM 1 znajdujący się na chromosomie 3q27 [35]. Wykazuje właściwości przeciwmiażdżycowe, przeciwzapalne i przeciwdiabetogenne. Produkowana jest przez zróżnicowane adipocyty i komórki macierzy tkankowej. Stwierdzono, że jej stężenia w krwi krążącej maleją w otyłości, cukrzycy typu 2, w przebiegu innych stanów związanych z insulinoopornością, m.in. w zespole policystycznych jajników, a także w nadciśnieniu tętniczym i chorobie niedokrwiennej serca [36, 37, 38, 39]. W badaniach eksperymentalnych wykazano, że w kłębuszkach nerkowych myszy pozbawionych adiponektyny dochodzi do wzrostu stresu oksydacyjnego i nasilenia albuminurii w skutek stapiania się wyrostków stopowatych podocytów oraz zaniku błony filtracyjnej. Podanie myszom adiponektyny prowadzi do normalizacji albuminurii i poprawy stanu wyrostków stopowatych podocytów [40, 41]. Jednakże w badaniu klinicznym u chorych z cukrzycą typu 1 wykazano, że to wysokie stężenia adiponektyny wiążą się z pojawieniem się mikroalbuminurii i progresją zaawansowanych stadiów CKD [42]. Z kolei analiza 227 hemodializowanych chorych w końcowym stadium CKD wykazała 2,5krotnie wyższe stężenia omawianej adipokiny w porównaniu z osobami zdrowymi, które korelowały ujemnie z BMI, stężeniem leptyny i insuliny, insulinoopornością i stężeniem triglicerydów. Jednakże to niższe stężenia adiponektyny wiązały się z wystąpieniem incydentów sercowo-naczyniowych tej grupy chorych [43]. Badając chorych z CKD, niedializowanych, Norata i wsp. wykazali związek między stężeniami adiponektyny a utratą

PRACE ORYGINALNE

246

Joanna Foremska-Iciek, Danuta Pupek-Musialik

funkcji wydzielniczej nerek oraz profilem metabolicznym badanych. Stwierdzili bowiem, że poziomy omawianej adipokiny korelują dodatnio ze stężeniem kreatyniny i HDL cholesterolem oraz ujemnie z eGFR, BMI i stężeniem triglicerydów [44]. Z kolei Guebre-Egziabher i wsp. dowiedli silniejszych zależności między omawianą adipokiną a wartościami BMI, białkomoczem oraz stężeniami leptyny niż z wykładnikami czynności nerek u pacjentów we wczesnych stadiach CKD [45]. W niniejszej pracy nie wykazano zależności między stężeniem adiponektyny a wartościami eGFR. Korelacje stężeń omawianej adipokiny z profilem antropometrycznym i metabolicznym chorych okazały się nieistotne statystycznie. Ujemną zależność stwierdzono jedynie między stężeniami adiponektyny a SBP. Uzyskane wyniki nie potwierdzają istotnej roli adiponektyny we wczesnych etapach dyfunkcji nerek badanej grupy chorych. Rozpatrując wpływ adipocytokin na uszkodzenia nerek u chorych z MS bierze się także pod uwagę leptynę. Leptyna jest białkiem o masie 16 kDa, kodowanym u ludzi przez gen OB zlokalizowany na chromosomie 7q31.3 [46]. Produkowana jest głównie przez białą podskórną tkankę tłuszczową, w mniejszym stopniu przez brunatną tkankę tłuszczową. W niewielkich ilościach wydzielana jest również przez komórki dna żołądka, mózgu, wątroby, łożyska i mięśni szkieletowych. Działając przez podwzgórze, hamuje łaknienie, przez co zmniejsza przyswajanie produktów energetycznych, a także pobudza termogenezę, przez co zwiększa wydatek energetyczny. Dodatkowo stymuluje aktywność układu współczulnego. Wiadomo również, że leptyna wywiera wpływ na angiogenezę, hematopoezę, aktywność układu odpornościowego, osteogenezę, wartości ciśnienia tętniczego oraz płodność. Działając promiażdżycowo sprzyja rozwojowi chorób układu sercowo-naczyniowego [47, 48, 49]. W badaniach eksperymentalnych wykazano, że wspomniana adipokina stymuluje rozplem komórek śródbłonka kłębuszków nerkowych a ponadto zwiększa produkcję transformującego czynnika wzrostu β1 (TGFβ1), który zwiększa odkładanie się kolagenu. W badaniach na szczurach zaobserwowano wystąpienie białkomoczu oraz rozplem komórek mezangium kłębuszków nerkowych w odpowiedzi na egzogenną podaż leptyny. Poza tym w obrębie wspomnianych komórek wykazano wzrost ekspresji receptora dla TGF β. Efektem tych procesów jest zwiększenie produkcji białek macierzy i postępujące szkliwienie kłębuszków nerkowych [50, 51]. Saginova z zespołem stwierdzili, że otyli chorzy z wczesnym stadium CKD charakteryzują się istotnie wyższymi stężeniemi leptyny, a także znacząco większymi wartościami BMI, obwodu talii i insulinoopornością w porównaniu z otyłymi bez uszkodzenia nerek. Wykazali istotne korelacje między stężeniami leptyny a BMI, insuliną, insulinoopornością, adiponektyną, albuminurią i CRP [52]. W badaniu klinicznym w populacji chorych z MS Okpechi i wsp. stwierdzili istotną ujemną korelację między wartościami eGFR [53]. W badaniu własnym chorych z MS cechowały istotnie wyższe stężenia leptyny niż osoby zdrowe. Stężenia te istotnie ujemnie korelowały z wartością eGFR, a ponadto

PRACE ORYGINALNE

dodatnio z BMI, stężeniami insuliny, insulinoopornością oraz procentową zawartością tkanki tłuszczowej w organizmie. Uzyskane wyniki nawiązują do wspomnianych wyżej badań i wskazują na związek hiperleptynenii nie tylko z zaburzeniami meatabolicznymi, ale także z upośledzoną czynnością nerek chorych z MS. Trzecią adipokiną braną pod uwagę w etiopatogenezie upośledzenia czynności nerek jest wisfatyna, białko 52 kDa kodowane przez geny znajdujące się na chromosomie 7. Wydzielana jest głównie przez adipocyty trzewnej tkanki tłuszczowej oraz naciekające ją makrofagi, choć obecna jest także w innych komórkach ustroju. Pierwotnie została zidentyfikowana jako PBEF, tj. czynnik wzrostu, stymulujący różnicowanie się kolonii komórek pre-B [54, 55]. Biologicznej roli wisfatyny do dziś w pełni nie poznano. Wiadomo, iż białko to pełni złożone funkcje immunologiczne oraz wykazuje działanie insulinomimetyczne, hipoglikemiczne i promiażdżycowe w następstwie indukcji dysfunkcji śródbłonka [55, 56, 57]. Niedawno opublikowana metaanaliza Changa i wsp. potwierdziła istotny związek wisfatyny z otyłością, insulinoopornością, rozwojem MS, chorób sercowo-naczyniowych, w tym cukrzycy typu 2 [58]. W nielicznym piśmiennictwie poświęconym udziałowi wisfatyny w patomechanizmie uszkodzenia nerek stwierdzono zwiększone jej stężenia w surowicy krwi chorych w zaawansowanych stadiach choroby oraz u hemodializowanych pacjentów, a także zwrócono uwagę na jej związek z wykładnikami dysfunkcji śródbłonka [59, 60, 61]. Ponadto u chorych z cukrzycą typu 2 i albuminurią wykazano istotną zależność między stężeniami wisfatyny a stopniem albuminurii [62]. U chorych w 4 i 5 stadium CKD Mu i wsp. stwierdzili związek między stężeniami wisfatyny, dysfunkcją śródbłonka i upośledzoną filtracją kłębuszkową. Wykazali bowiem, że zwiększone stężenia wspomnianej adipokiny istotnie korelowały z CRP, stężeniami triglicerydów, LDL cholesterolu i grubością kompleksu intima-media (intimamedia thickness, IMT) oraz ujemnie z wartością eGFR, stężeniem HDL cholesterolu i stopniem rozszerzenia tętnicy ramiennej po uprzedniej okluzji tętnic przedramienia (flowmediated dilatation, FMD) [63]. Badając 406 chorych z CKD, bez cukrzycy, Yilmaz i wsp. stwierdzili, że stężenia wisfatyny były istotnie wyższe tylko w zaawansowanych stadiach choroby, tj. w 3, 4 i 5 stadium. Analiza statystyczna wykazała obecność istotnej korelacji między stężeniami wisfatyny a eGFR, a także znamiennych zależności między tą adipokiną, eGFR a dysfunkcją śródbłonka mierzoną za pomocą FMD [64]. W niniejszej pracy nie wykazano istotnych różnic w stężeniach wisfatyny między grupą badaną a kontrolną. Nie stwierdzono znaczących zależności między wspomnianą adipokiną w wartościami eGFR. Istotne korelacje stwierdzono jedynie między stężeniami wisfatyny a SBP i DBP. Uzyskane rezultaty nie wskazują na udział wisfatyny w patogenezie wczesnej fazy uszkodzenia nerek, a jedynie przemawiają za jej wpływem na wartości ciśnienia tętniczego. Niezbędne są dalsze badania, na większej populacji, celem poznania mechanizmów działania wisfatyny w tej grupie chorych.

Ocena zależności między stężeniami wybranych adipokin, parametrami biochemicznymi i antropometrycznymi …

Wnioski 1. Chorzy z MS cechują się istotnie wyższymi stężeniami kreatyniny w surowicy krwi oraz niższymi wartościami eGFR w porównaniu z osobami zdrowymi, co przemawia za uszkadzającym wpływem zespołu na czynność nerek. 2. Wykazana zależność między stężeniami leptyny a eGFR może świadczyć o udziale tej adipokiny w patogenezie uszkodzenia nerek w przebiegu MS. 3. Brak zależności między wartościami eGFR a wykładnikami otyłości, wartościami ciśnienia tętniczego, parametrami gospodarki lipidowej i węglowodanowej nie wskazuje na istotny udział tych czynników we wczesnych etapach uszkadzania kłębuszków nerkowych badanej grupy chorych. Piśmiennictwo 1. Ford E.S., Giles W.H., Dietz W.H.: Prevalence of the metabolic syndrome among US adults. Findings from the Third National Health and Nutrition Examination Survey. JAMA, 2002, 287, 356-359. 2. Balkau B., Charles M.A., Drivsholm T. i wsp.: The European Group for the Study of Insulin Resistance (EGIR): Frequency of the WHO metabolic syndrome in European cohorts, and an alternative definition of an insulin resistance syndrome. Diabetes Metab., 2002, 28, 364-376. 3. Wyrzykowski B., Zdrojewski T., Sygnowska E. i wsp.: Epidemiologia zespołu metabolicznego w Polsce. Wyniki programu WOBASZ. Kardiol. Pol., 2005, 63 (supl. 4), 14. 4. Isomaa B., Almgren P., Tuomi T. i wsp.: Cardiovascular morbidity and mortality associated with metabolic syndrome. Diabetes Care, 2001, 24(4), 683-689. 5. Vanuzzo D., Pilotto L., Mirolo R. i wsp.: Cardiovascular risk and cardiometabolic risk: an epidemiological evaluation. G. Ital. Cardiol. (Rome), 2008, 9(4 Suppl 1), 6S-17S. 6. Navaneethan S.D., Schold J.D., Srinivas T.R.: Metabolic syndrome and mild to moderate chronic kidney disease among minorities. Semin. Nephrol., 2010, 30(1), 51-58. 7. Chen J., Muntner P., Hamm L.L. i wsp.: The metabolic syndrome and chronic kidney disease in U.S. adults. Ann. Intern. Med., 2004, 140(3), 167-174. 8. Wang Y., Chen X., Song Y. i wsp.: Association between obesity and kidney disease: a systematic review and meta-analysis. Kidney Int., 2008, 73(1), 19-33. 9. Hall J.E., Crook E.D., Jones D.W. i wsp.: Mechanisms of obesity-associated cardiovascular and renal disease. Am. J. Med. Sci., 2002, 324(3), 127-137. 10. Lerman L.O., Lerman A.: The metabolic syndrome and early kidney disease: another link in the chain? Rev. Esp. Cardiol., 2011, 64(5), 358-360. 11. Piecha G., Więcek A.: Przewlekła choroba nerek u osób otyłych – patogeneza i leczenie. Przewodnik Lekarza, 2012, 46-50. 12. Dengel D.R., Goldberg A.P., Mayuga R.S. i wsp.: Insulin resistance, elevated glomerular filtration fraction, and renal injury. Hypertension, 1996, 28(1), 127-132. 13. Sowers J.R., Whaley-Connell A., Epstein M.: Narrative review: the emerging clinical implications of the role

14.

15.

16.

17.

18.

19. 20.

21.

22. 23. 24.

25.

26.

27. 28.

29.

247

of aldosterone in the metabolic syndrome and resistant hypertension. Ann. Intern. Med., 2009, 150(11), 776-783. Shibata S., Nagase M., Yoshida S. i wsp.: Modification of mineralocorticoid receptor function by Rac1 GTPase: implication in proteinuric kidney disease. Nat. Med., 2008, 14(12), 1370-1376. Alberti K.G., Zimmet P., Shaw J.: IDF Epidemiology Task Force Consensus Group: The metabolic syndrome – a New Word-wide definition. Lancet, 2005, 366, 10591062. Widecka K., Grodzicki T., Narkiewicz K. i wsp.: Zasady postępowania w nadciśnieniu tętniczym – 2011 rok. Wytyczne Polskiego Towarzystwa Nadciśnienia Tętniczego. Nadciśnienie Tętnicze, 2011, 15 (2), 55-82. Thomas G., Sehgal A.R., Kashyap S.R. i wsp.: Metabolic syndrome and kidney disease: a systematic review and meta-analysis. Clin. J. Am. Soc. Nephrol., 2011, 6(10), 2364-2373. Gatti A., Morini E., De Cosmo S. i wsp.: Metabolic syndrome is not a risk factor for kidney dysfunction in obese non-diabetic subjects. Obesity (Silver Spring), 2008, 16 (4), 899-901. Kawamoto R., Kohara K., Tabara Y. i wsp.: An association between metabolic syndrome and the estimated glomerular filtration rate. Intern. Med., 2008, 47(15), 1399-1406. Johns B.R., Pao A.C., Kim S.H.: Metabolic syndrome, insulin resistance and kidney function in non-diabetic individuals. Nephrol. Dial. Transplant., 2012, 27(4), 1410-1415. Okpechi I.G., Pascoe M.D., Swanepoel C.R. i wsp.: Microalbuminuria and the metabolic syndrome in nondiabetic black Africans. Diab.Vasc. Dis. Res., 2007, 4(4), 365-367. Landecho M.F., Colina I., Huerta A. i wsp.: Connection between the early phases of kidney disease and the metabolic syndrome. Rev. Esp. Cardiol., 2011, 64(5), 373-378. Henegar J.R., Bigler S.A., Henegar L.K. i wsp.: Functional and structural changes in the kidney in the early stages of obesity. J. Am. Soc.Nephrol., 2001, 12(6), 1211-1217. Wuerzner G., Pruijm M., Maillard M. i wsp.: Marked association between obesity and glomerular hyperfiltration: a cross-sectional study in an African population. Am. J. Kidney Dis., 2010, 56 (2), 303-312. Chagnac A., Herman M., Zingerman B. i wsp.: Obesityinduced glomerular hyperfiltration: its involvement in the pathogenesis of tubular sodium reabsorption. Nephrol. Dial. Transplant., 2008, 23(12), 3946-3952. Yoshida T., Takei T., Shirota S. i wsp.: Risk factors for progression in patients with early-stage chronic kidney disease in the Japanese population. Intern. Med., 2008, 47(21), 1859-1864. Kawamoto R., Kohara K., Tabara Y. i wsp.: An association between body mass index and estimated glomerular filtration rate. Hypertens. Res., 2008, 31(8), 1559-1564. Othman M., Kawar B., El Nahas A.M.: Influence of obesity on progression of non-diabetic chronic kidney disease: a retrospective cohort study. Nephron Clin. Pract., 2009, 113(1), 16-23. Burton JO., Gray L.J., Webb D.R. i wsp.: Association of anthropometric obesity measures with chronic kidney disease risk in a non-diabetic patient population. Nephrol. Dial. Transplant., 2012, 27(5), 1860-1866.

PRACE ORYGINALNE

248

Joanna Foremska-Iciek, Danuta Pupek-Musialik

30. Kansui Y., Ohtsubo T., Goto K. i wsp.: Association of body mass index with glomerular filtration rate in Japanese: a cross-sectional study in work-site population. Clin. Exp. Hypertens., 2012, 34(2), 140-144. 31. Hobbs H., Farmer C., Irving J. i wsp.: Is high body mass index independently associated with diminished glomerular filtration rate? An epidemiological study. J. Ren. Care, 2011, 37(3), 148-154. 32. Brown R.N., Mohsen A., Green D. i wsp.: Body mass index has no effect on rate of progression of chronic kidney disease in non-diabetic subjects. Nephrol. Dial. Transplant., 2012 Mar 22. [Epub ahead of print]. 33. Khedr A., Khedr E., House A.A.: Body mass index and the risk of progression of chronic kidney disease in patients with eGFR < 60 mL/min/1.73 m2. J. Ren. Nutr., 2011, 21(6), 455-461. 34. Obermayr R.P., Temml C., Gutjahr G. i wsp.: Body mass index modifies the risk of cardiovascular death in proteinuric chronic kidney disease. Nephrol. Dial. Transplant., 2009, 24(8), 2421-2428. 35. Takahashi M., Arita Y., Yamagata K. i wsp.: Genomic structure and mutations in adipose-specific gene, adiponectin. Int. J. Obes. Relat. Metab. Disord., 2000, 24(7), 861-868. 36. Kumada M., Kihara S., Sumitsuji S. i wsp.: Osaka CAD Study Group. Coronary artery disease. Association of hypoadiponectinemia with coronary artery disease in men. Arterioscler. Thromb. Vasc. Biol., 2003, 23(1), 8589. 37. Frayn K.N., Karpe F., Fielding B.A. i wsp.: Integrative physiology of human adipose tissue. Int. J. Obes. Relat. Metab. Disord., 2003, 27(8), 875-888. 38. Toulis K.A., Goulis D.G., Farmakiotis D. i wsp.: Adiponectin levels in women with polycystic ovary syndrome: a systematic review and a meta-analysis. Hum. Reprod. Update, 2009, 15(3), 297-307. 39. Adamczak W., Więcek A., Funahashi T. i wsp.: Decreased plasma adiponectin concentrations in patients with essential hypertension. Am. J. Hypertension, 2003, 16 (1), 72-75. 40. Ix J.H., Sharma K.: Mechanisms linking obesity, chronic kidney disease and fatty liver disease: the roles of fetuinA, adiponectin, and AMPK. J. Am. Soc.Nephrol., 2010, 21(3), 406-412. 41. Sharma K., Ramachandrarao S., Qiu G. i wsp.: Adiponectin regulates albuminuria and podocyte function in mice. J. Clin. Invest., 2008, 118(5), 1645-1656. 42. Hadjadj S., Aubert R., Fumeron F. i wsp.: SURGENE Study Group; DESIR Study Group. Increased plasma adiponectin concentrations are associated with microangiopathy in type 1 diabetic subjects. Diabetologia, 2005, 48(6), 1088-1092. 43. Zoccali C., Mallamaci F., Tripepi G. i wsp.: Adiponectin, metabolic risk factors, and cardiovascular events among patients with end-stage renal disease. J. Am. Soc. Nephrol., 2002, 13(1), 134-141. 44. Norata G.D., Baragetti I., Raselli S. i wsp.: Plasma adiponectin levels in chronic kidney disease patients: relation with molecular inflammatory profile and metabolic status. Nutr. Metab. Cardiovasc. Dis., 2010, 20(1), 56-63. 45. Guebre-Egziabher F., Bernhard J., Funahashi T. i wsp.: Adiponectin in chronic kidney disease is related more to metabolic disturbances than to decline in renal function. Nephrol. Dial. Transplant., 2005, 20(1), 129-134.

PRACE ORYGINALNE

46. Zhang Y., Proenca R., Maffei M. i wsp.: Positional cloning of the mouse obese gene and its human homologue. Nature, 1994, 372(6505), 425-432. 47. Ahima R.S., Osei S.Y.: Leptin signaling. Physiol.Behav., 2004, 81(2), 223-241. 48. Bełtowki J.: Leptin and atherosclerosis. Atherosclerosis, 2006, 189(1), 47-60. 49. Szadkowska A.: Adipokiny. Urban M (red.) Miażdżyca u dzieci i młodzieży. Cornetis sp. z o.o., Wrocław 2007, 269-285. 50. Wolf G., Chen S., Han D.C. i wsp.: Leptin and renal disease. Am. J. Kidney Dis., 2002, 39(1), 1-11. 51. Wolf G., Hamann A., Han D.C. i wsp.: Leptin stimulates proliferation and TGF-beta expression in renal glomerular endothelial cells: potential role in glomerulosclerosis. Kidney Int., 1999, 56(3), 860-872. 52. Saginova E.A., Galliamov M.G., Severova M.M. i wsp.: The role of leptin, adiponectin and insulin-resistance markers in development of early stages of chronic kidney disease and atherosclerosis of carotid arteries in obese patients. Ter Arkh, 2011, 83(6), 47-53. 53. Okpechi I.G., Pascoe M.D., Swanepoel C.R. i wsp.: Microalbuminuria and the metabolic syndrome in nondiabetic black Africans. Diab.Vasc. Dis. Res., 2007, 4(4), 365-367. 54. Samal B., Sun Y., Stearns G. i wsp.: Cloning and characterization of cDNA encoding a novel human pre-B-cell colony-enhancing factor. Mol. Cell Biol., 1994, 14(2), 1431-1437. 55. Fukuhara A., Matsuda M., Nishizawa M. i wsp.: Visfatin: a protein secreted by visceral fat that mimics the effects of insulin. Science, 2005, 307(5708), 426-430. 56. Jia S.H., Li Y., Parodo J. i wsp.: Pre-B colony enhancing factor inhibits neutrophil apoptosis in experimental inflammation and clinical sepsis. J. Clin. Invest., 2004, 113(9). 1318-1327. 57. Lee W.J., Wu C.S., Lin H. i wsp.: Visfatin-induced expression of inflammatory mediators in human endothelial cells through the NF-kappaB pathway. Int. J. Obes. (Lond), 2009, 33(4), 465-472. 58. Chang Y.H., Chang D.M., Lin K.C. i wsp.: Visfatin in overweight/obesity, type 2 diabetes mellitus, insulin resistance, metabolic syndrome and cardiovascular diseases: a meta-analysis and systemic review. Diabetes Metab. Res. Rev., 2011, 27(6), 515-527. 59. Kato A., Odamaki M., Ishida J. i wsp.: Relationship between serum pre-B cell colony-enhancing factor/visfatin and atherosclerotic parameters in chronic hemo-dialysis patients. Am. J. Nephrol., 2009, 29(1), 31-35. 60. Nüsken K.D., Petrasch M., Rauh M. i wsp.: Active visfatin is elevated in serum of maintenance haemodialysis patients and correlates inversely with circulating HDL cholesterol. Nephrol. Dial. Transplant., 2009, 24(9), 2832-2838. 61. Axelsson J., Witasp A., Carrero J.J. i wsp.: Circulating levels of visfatin/pre-B-cell colony-enhancing factor 1 in relation to genotype, GFR, body composition, and survival in patients with CKD. Am. J. Kidney Dis., 2007, 49(2), 237-244. 62. Yilmaz M.I., Saglam M., Qureshi A.R. i wsp.: Endothelial dysfunction in type-2 diabetics with early diabetic nephropathy is associated with low circulating adiponectin. Nephrol. Dial. Transplant., 2008, 23(5), 1621-1627.

Ocena zależności między stężeniami wybranych adipokin, parametrami biochemicznymi i antropometrycznymi … 63. Mu J., Feng B., Ye Z. i wsp.: Visfatin is related to lipid dysregulation, endothelial dysfunction and atherosclerosis in patients with chronic kidney disease. J. Nephrol., 2011, 24(2), 177-184. 64. Yilmaz M.I., Saglam M., Carrero J.J. i wsp.: Serum visfatin concentration and endothelial dysfunction in chronic kidney disease. Nephrol. Dial. Transplant., 2008, 23(3), 959-965.

249

Dane do korespondencji: Joanna Foremska-Iciek [email protected] tel.: 61 854 93 77 fax: 61 847 85 29 Katedra i Klinika Chorób Wewnętrznych, Zaburzeń Metabolicznych i Nadciśnienia Tętniczego Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu ul. Szamarzewskiego 82/84 60-569 Poznań

PRACE ORYGINALNE

Nowiny Lekarskie 2011, 80, 4, 250–257

KATARZYNA PLAGENS-ROTMAN1,2, GRAŻYNA BĄCZYK2,3, SŁAWOMIRA KUBIAK3,4, DOROTA BERNAD2, MONIKA PYSZCZORSKA2, RENATA PRZYBYLSKA2

KRWAWIENIA WEWNĄTRZCZASZKOWE U NOWORODKÓW Z EKSTREMALNIE MAŁĄ URODZENIOWĄ MASĄ CIAŁA INTRACRANIAL HEMORRHAGES IN THE EXTREMELY LOW BIRTH WEIGHT INFANTS 1

Klinika Położnictwa i Chorób Kobiecych Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Kierownik: prof. dr hab. med. Jacek Brązert 2 Katedra Pielęgniarstwa Wydziału Nauk o Zdrowiu Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Kierownik: dr n. biol. Grażyna Bączyk 3 Instytut Nauk o Zdrowiu Państwowej Wyższej Szkoły Zawodowej Kierownik: prof. dr hab. Michał Umbreit 4 Katedra Neonatologii Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Kierownik: prof. dr hab. n. med. Janusz Gadzinowski

Streszczenie Wstęp. Dynamiczny rozwój metod intensywnej terapii noworodka znajduje odzwierciedlenie we wzroście przeżywalności noworodków z ekstremalnie małą urodzeniową masą ciała, nie wpływa jednak zasadniczo na częstość występowania krwawień wewnątrzczaszkowych. Krwawienia te nadal kształtują niekorzystnie zachorowalność i umieralność noworodków o znacznej niedojrzałości. Cel. Celem pracy była analiza częstości występowania krwawień wewnątrzczaszkowych u noworodków z ekstremalnie małą urodzeniową masą ciała urodzonych w Katedrze Neonatologii UM w Poznaniu w latach 2002–2005. Materiał i metody. Zgromadzone dane dotyczyły 213 noworodków ELBW. Przedstawiono ocenę wpływu wybranych czynników ryzyka na wystąpienie krwawień do OUN i stopień ich nasilenia. Wyniki. Noworodki z ekstremalnie małą urodzeniową masą ciała stanowiły 1,63% wszystkich żywo urodzonych noworodków. Częstość krwawień wewnątrzczaszkowych wyniosła w badanym materiale 55,61%. Wnioski. Zachorowalność i umieralność noworodków w dużym stopniu zależna jest od urodzeniowej masy ciała, a szansa na przeżycie bez powikłań jest odwrotnie proporcjonalna do urodzeniowej masy ciała i wieku ciążowego noworodka. SŁOWA KLUCZOWE: krwawienia wewnątrzczaszkowe, noworodek, zachorowalność, umieralność.

Summary Introduction. The dynamic development of infant intensive therapy methods is reflected in the increase of the extremely low birth weight (ELBW) infants survival rate, although it has no significant impact on the incidence of intraventricular (IVH) hemorrhages. In most cases the hemorrhages have negative impact on morbidity and mortality of neonates with considerable immaturity. Aim. The aim of this study was to analyze the incidence of intraventricular (IVH) hemorrhages in the extremely low birth weight infants hospitalized in the Department of Neonatology of Poznan University of Medical Sciences in years 2002–2005. Method. The relationship between the risk factors of IVH and its intensity was analyzed. Results. Extremely low birth weight infants constituted 1.63% of live births in the examined population. The incidence of IVH in this group was 55.67%. Conclusions. Morbidity and mortality of neonates including ELBW infants depends markedly upon their birth weight. Their chance of survival without major complications is inversely proportional to their birth weight and gestational age. KEY WORDS: intracranial hemorrhages, neonate, morbidity, mortality.

Wstęp Jeszcze do niedawna utrzymanie przy życiu noworodków z urodzeniową masą ciała poniżej 1000 g wydawało się niemożliwe. Rozwój medycyny perinatalnej oraz nowoczesnych metod leczenia spowodował przekroczenie limitu 1000 g jako dolnej granicy dojrzałości płodu umożliwiającej podjęcie i kontynuowanie podstawowych funkcji życiowych organizmu [1, 2]. Noworodki z ekstremal-

PRACE ORYGINALNE

nie małą urodzeniową masą ciała stanowią około 0,6–1% wszystkich żywo urodzonych dzieci, a ich przeżywalność sięga 80% [3]. Długotrwałe leczenie w oddziale intensywnej terapii noworodka wiąże się z szeregiem powikłań związanych ze skrajnym wcześniactwem. Jednym z najpoważniejszych zagrożeń obok chorób płuc i układu krążenia jest uszkodzenie OUN przebiegające pod postacią krwawień śródczaszkowych i zmian leukomalacyjnych.

Krwawienia wewnątrzczaszkowe u noworodków z ekstremalnie małą urodzeniową masą ciała

251

W etiopatogenezie krwawień śródczaszkowych podstawowe znaczenie mają zmiany przepływu mózgowego towarzyszące wielu chorobom okresu noworodkowego. Ryzyko wystąpienia krwawienia dokomorowego jest wyższe u noworodków z chorobami układu oddechowego, u dzieci z drożnym przewodem tętniczym, a także w trakcie krótkotrwałych zaburzeń krążenia systemowego [4, 5]. Obszarem mózgu wcześniaka szczególnie narażonym na krwawienie jest podwyściółkowa strefa zarodkowa, zlokalizowana między jądrem ogoniastym i wzgórzem, w okolicy komór bocznych mózgu. Krwotoki do strefy rozrodczej mogą penetrować do komór, jak również zająć parenchymę mózgu. Podstawą precyzyjnej oceny rozległości krwawień jest ich klasyfikacja w obrazie ultrasonograficznym według ujednoliconej czterostopniowej skali Papille’a (Tabela 1). Tabela 1. Klasyfikacja krwawień dokomorowych wg Papille’a [6] Table 1. Papille classification of intraventricular hemorrhage [6] Stopień krwawienia I stopień II stopień III stopień IV stopień

Rodzaj zmian w obrazie ultrasonograficznym mózgowia Krwawienie podwyściółkowe Krwawienie dokomorowe bez poszerzenia komór Krwawienie dokomorowe z poszerzeniem komór Krwawienie dokomorowe z krwawieniem do miąższu mózgu

Około 90% krwawień dokonuje się w ciągu pierwszych 72 godzin życia dziecka. Wobec tego zaleca się, aby u noworodków z grupy ryzyka wykonywać USG przezciemieniowe w 3. dobie życia (Rycina 1).

Rycina 1. USG przezciemieniowe mózgowia u wcześniaka urodzonego w 25. tygodniu ciąży: IVH II° (materiały własne). Figure 1. Transfontanelle USG of the brain of preterm infant born in 25th week of pregnancy: IVH II (own materials).

W momencie wprowadzenia USG mózgowia okazało się, że często IVH przebiega bezobjawowo, dlatego postawienie diagnozy wyłącznie na podstawie obserwacji klinicznej jest niemożliwe (Rycina 2) [7].

Rycina 2. USG przezciemieniowe mózgowia u wcześniaka urodzonego w 28. tygodniu ciąży: A – IVH III°, B i C – IVH IV° do prawej komory (materiały własne). Figure 2. Transfontanelle USG of the brain of preterm infant born in 28th week of pregnancy: A – IVH III°, B and C – IVH IV° to the right ventricle (own materials).

PRACE ORYGINALNE

252

Katarzyna Plagens-Rotman i inni

Rokowanie u dzieci po przebytym krwawieniu wewnątrzczaszkowym zależy od stopnia krwawienia oraz uszkodzenia ośrodkowego układu nerwowego. W przypadku łagodnej formy choroby – I i II stopień krwawień śródczaszkowych – rokowanie jest porównywalne do noworodków urodzonych w tym samym okresie ciąży bez krwawienia. Trzeci stopień krwawienia może wiązać się z powstaniem wodogłowia oraz zaburzeniami rozwoju psychomotorycznego dziecka. Śmiertelność noworodków z IV stopniem krwawienia jest bardzo duża i wynosi 80–90%. U dzieci, które przeżywają, zwykle występuje wodogłowie oraz nasilone zaburzenia rozwoju psychoruchowego (Rycina 3). Znacznie częściej obserwuje się zaburzenia słuchu, wady wzroku, obniżone parametry rozwoju somatycznego oraz mózgowe porażenie dziecięce.

niową masą ciała. Materiał do badań nie obejmował noworodków urodzonych w szpitalach I i II stopnia referencyjności i transportowanych do Katedry Neonatologii po urodzeniu. Ocenie poddano następujące parametry: płeć dziecka, wiek płodowy, obecność zmian patologicznych w obrębie ośrodkowego układu nerwowego (krwawienia śródczaszkowe, leukomalacja okołokomorowa, wodogłowie pokrwotoczne). Przeanalizowano stan ogólny noworodka w skali Apgar w pierwszej i piątej minucie życia oraz współistnienie patologii układu oddechowego takich jak: zespół zaburzeń oddychania (ZZO) leczony podaniem surfaktantu, odma opłucnowa oraz występowanie dysplazji oskrzelowo-płucnej (BPD). Ponadto poddano analizie śmiertelność noworodków z IVH w zależności od urodzeniowej masy ciała, wieku ciążowego oraz stopnia nasilenia krwawienia do OUN. Dane opracowano z podziałem na pięć podgrup w zależności od urodzeniowej masy ciała: 500–600 g, 601– 700 g, 701–800 g, 801–900 g, 901–1000 g. Rozpoznanie zmian patologicznych w obrębie OUN ustalono na podstawie ultrasonograficznego przezciemiączkowego badania mózgowia. Pierwsze badanie USG wykonane było w ciągu 72 godzin od urodzenia dziecka, a następnie powtarzano je kilkakrotnie w czasie pobytu dziecka w oddziale. Stopień krwawienia do ośrodkowego układu nerwowego oceniano według czterostopniowej skali Papille’a. Uzyskane wyniki badań opracowano w oparciu o test chi kwadrat oraz test Fishera-Freemana-Haltona. Za poziom istotności statystycznej przyjęto poziom p < 0,05.

Rycina 3. USG przezciemieniowe mózgowia u wcześniaka urodzonego w 26. tygodniu ciąży: Wodogłowie pokrwotoczne. W okolicy rogu czołowego komory bocznej zmiany leukomalacyjne. Światło obu komór bocznych wypełnione skrzepami (materiały własne). Figure 3. Transfontanelle USG of the brain of preterm infant born in 26th week of pregnancy: post-hemorrhagic hydrocephalus. Leukomalacia changes in the area of the frontal horn of side ventricle. The lumen of both side ventricles filled with clots (own materials).

Wyniki W latach 2002–2005 w Katedrze Neonatologii Ginekologiczno-Położniczego Szpitala Klinicznego UM w Poznaniu urodziło się 23396 noworodków. Badaniem objęto 383 noworodki z ekstremalnie małą urodzeniową masą ciała, co stanowi 1,63% wszystkich żywo urodzonych dzieci. Na rycinie 4 graficznie przedstawiono procentowy rozkład urodzeniowej masy ciała u noworodków ELBW (Rycina 4).

Cel Celem pracy była analiza częstości występowania krwawień wewnątrzczaszkowych u noworodków z ekstremalnie małą urodzeniową masą ciała hospitalizowanych w Katedrze Neonatologii im. Karola Marcinkowskiego w Poznaniu w latach 2002–2005, z uwzględnieniem zgonów noworodków w zależności od stopnia nasilenia krwawienia do OUN. Materiał i metody Materiał do badań stanowiły dane dotyczące 23396 noworodków urodzonych w Katedrze Neonatologii UM w Poznaniu w okresie od 1.01.2002 do 31.12.2005. Analizie retrospektywnej poddano historie chorób 383 żywo urodzonych noworodków z ekstremalnie małą urodze-

PRACE ORYGINALNE

Rycina 4. Procentowy rozkład masy ciała w badanej grupie noworodków ELBW. Figure 4. Percentage distribution of body weight in the group of ELBW infants [g].

Krwawienia wewnątrzczaszkowe u noworodków z ekstremalnie małą urodzeniową masą ciała

253

ogólnym dobrym urodziło się 22 dzieci, co stanowiło 10,33 % badanej populacji. Zależność pomiędzy urodzeniową masą ciała, a częstością krwawienia do OUN przedstawia rycina 5. Nie stwierdzono wyraźnej współzależności pomiędzy występowaniem krwawienia do OUN a urodzeniową masą ciała (p = 0,6233). Częstość występowania IVH u noworodków była zbliżona we wszystkich grupach wagowych. Analizie poddano również częstość i stopień nasilenia krwawienia do OUN w zależności od wieku ciążowego noworodka w chwili porodu. Zestawienia przedstawiono w tabeli 3. Stwierdzono istotną statystycznie zależność pomiędzy występowaniem IVH, a wiekiem płodowym (p = 0,009972). Analizując płeć noworodków z krwawieniami do OUN wykazano, iż rozkład płci jest równomierny z niewielką przewagą płci żeńskiej (51,17%), ale różnica ta nie była istotnie statystyczna (p = 0,3457). W analizowanym materiale nie stwierdzono istotnej statystycznie zależności pomiędzy obecnością IVH, a występowaniem niewydolności oddechowej (p = 0,6572).

Wśród ogółu badanych dzieci krwawienia śródczaszkowe (IVH – Intraventricular Haemorrhage) rozpoznano u 213 noworodków co stanowiło 55,61% omawianej populacji. Krwawienie I stopnia rozpoznano u 25 noworodków (11,74%), a III i IV stopnia odpowiednio u 55 (26,08%) i 44 (20,66%) dzieci. Najczęściej występowało krwawienie II stopnia (89 noworodków, 44,79%). Za pomocą cięcia cesarskiego urodziło się 114 dzieci, a siłami natury 99. Wskazaniem do cięcia cesarskiego w przeważającej liczbie przypadków były objawy zagrożenia życia płodu. Powikłaniami położniczymi mającymi bezpośredni wpływ na ukończenie ciąży było wypadnięcie części drobnych płodu oraz patologie łożyska. U matek noworodków z ELBW najczęstszą przyczyną ukończenia ciąży było nadciśnienie tętnicze oraz cukrzyca. Większość noworodków badanej populacji urodziła się w stanie ogólnym ciężkim (punktacja w skali Apgar w pierwszej minucie życia w przedziale 0–3 punktów) (Tabela 2). W piątej minucie życia na 0–3 punktów w skali Apgar oceniono 23 noworodki (10,8%) a na 4–7 punktów w skali Apgar 168 noworodków (78,87%). W stanie

Tabela 2. Ocena stanu ogólnego noworodków wg skali Apgar w 1. minucie życia Table 2. One minute Apgar assessment Skala Apgar (pkt) 0–3

21 51 47 44

Procent noworodków danego przedziału wagowego z IVH 9,86 % 23,95% 22,07 % 20, 65 %

901–1000

50

23,47 %

20

9,38

25

11,78

5

2,35

Razem

213

100 %

123

57,75

82

38,5

8

3,75

URODZENIOWA MASA CIAŁA [g] 500–600 601–700 701–800 801–900

IVH

4–7

8–10

Ilość

%

Ilość

%

Ilość

%

18 37 29 19

8,45 17,37 13,62 8,92

2 13 18 24

0,94 6,1 8,45 11,27

1 1 0 1

0,47 0,47 0 0,47

Rycina 5. Zależność częstości występowania krwawień wewnątrzczaszkowych od urodzeniowej masy ciała w badanej grupie noworodków ELBW. Figure 5. Dependency of intracranial hemorrhage from birth weight (g) in the examined group of ELBW infants.

PRACE ORYGINALNE

254

Katarzyna Plagens-Rotman i inni

Tabela 3. Występowanie krwawienia wewnątrzczaszkowego w zależności od wieku ciążowego Table 3. Frequency of intracranial hemorrhage depending on gestational age Wiek ciążowy [tg] ≤ 23 24–26 27–28 29–30 > 31

Razem

Stopień krwawienia do OUN II

I

III

IV

N

%

N

%

N

%

N

%

N

%

18 114 47 21 13

8,45 53,52 22,06 9,86 6,11

7 8 8 2

28 32 32 8

6 50 16 8 9

6,74 55,17 17,99 8,99 10,11

7 30 13 3 2

12,72 54,55 23,64 5,45 3,64

5 27 10 2 -

11,36 61,36 22,72 4,56 -

Tabela 4. Krwawienie do OUN a wybrane czynniki ryzyka Table4. Hemorrhage to CNS and selected risk factors Czynniki ryzyka

IVH I

IVH II

IVH III

IVH IV

Razem

Hipotrofia wewnątrzmaciczna

Obecna

8

12

22

25

104

Brak

17

77

33

19

109

Zakażenie wewnątrzmaciczne

Obecne

7

24

18

11

60

Brak

18

65

37

33

153

Niewydolność oddechowa

Obecna

24

88

53

42

207

Brak

1

1

2

2

6

Podanie surfaktantu

Obecne

7

55

39

26

127

Brak

18

34

16

18

86

Rodzaj porodu Odma opłucnowa

Fizjologiczny

9

35

32

27

103

Cięcie cesarskie

16

54

23

17

110

Obecne

3

3

3

2

9

Brak

22

86

54

42

204

97,18 % noworodków z ELBW wymagało mechanicznej wentylacji. Większość z nich (119 dzieci, 55,86%) wymagała podania surfaktantu. Ponad 30,98% tych dzieci wymagało podania więcej niż jednej dawki surfaktantu. Dotchawicze podanie surfaktantu jest czynnikiem ryzyka mającym wpływ na wystąpienie i nasilenie krwawień do OUN. Pozostałe czynniki ryzyka wpływające na występowanie IVH przedstawia tabela 4. W badanej grupie noworodków oprócz krwawień do ośrodkowego układu nerwowego najczęściej stwierdzanymi problemami klinicznymi były zespół zaburzeń oddychania, niedokrwistość oraz przetrwały przewód tętniczy (PDA – Patent Ductus Arteriosus). W badanej populacji noworodków z IVH rozpoznano 6 nieprawidłowości układu krążenia występujących łącznie u 94 dzieci (44,13%). Najczęstszą wrodzoną wadą serca był przetrwały przewód tętniczy zdiagnozowany u 68 dzieci (31,92%), a następnie drożny otwór owalny (FOA – Foramen Ovale) – 8,92%. Rzadziej obserwowano ubytek w przegrodzie międzykomorowej (2,34%) oraz ubytek w przegrodzie międzyprzedsionkowej. Tetralogia Fallota została rozpoznana u 2 noworodków, co stanowiło 0,93% populacji.

PRACE ORYGINALNE

p < 0,05 p = 0,000002481 p = 0,8566 p = 0,6572 p = 0,003411 p = 0,02262 p = 0,195

W przeprowadzonej analizie u 30 (14,08%) dzieci z rozpoznanym przetrwałym przewodem tętniczym Botalla zastosowano leczenie farmakologiczne. Chirurgiczną ligację przewodu tętniczego wykonano u 35 noworodków z IVH, co stanowiło 16,43% badanej populacji. Wśród noworodków z IVH częstość nabytego zapalenia płuc wynosiła 31,92%, a zakażenia układu moczowego 11,26%. Posocznica została rozpoznana u 19 noworodków, co stanowiło 8,92% badanej populacji. Częstym powikłaniem krwawienia do OUN jest wodogłowie pokrwotoczne i leukomalacja okołokomorowa (PVL – Periventricular Leukomalacia). W badanej grupie dzieci PVL wystąpiła u 27 noworodków, co stanowiło 7,05% ogółu badanych. U wszystkich dzieci wystąpienie PVL poprzedzone było krwawieniem wewnątrzczaszkowym. Krwawienia wewnątrzczaszkowe III i IV stopnia poprzedzały wystąpienie PVL u 17 (63%) noworodków, IVH II stopnia u 8 (29,60%) noworodków, IVH I stopnia u 2 (7,40%) noworodków. Zależność występowania PVL od urodzeniowej masy ciała przedstawia tabela 5.

Krwawienia wewnątrzczaszkowe u noworodków z ekstremalnie małą urodzeniową masą ciała

255

Tabela 5. Występowanie leukomalacji okołokomorowej u noworodków ELBW Table 5. Periventricular leukomalacia in ELBW infants Leukomalacja okołokomorowa (PVL) N % 1 1,96 8 9,20 5 5,81 7 9,46 6 7,06 27 7,05

Urodzeniowa masa ciała [g] 500–600 601–700 701–800 801–900 901–1000 Razem

Tabela 6. Śmiertelność noworodków z ELBW, u których wystąpiło krwawienie wewnątrzczaszkowe III i IV stopnia Table 6. Death rate in ELBW infants with intracranial hemorrhage of IIIo and IVo Czas zgonu [doby]

500–600

Urodzeniowa masa ciała [g] 701–800

601–700

801–900

901–1000

N

%

N

%

N

%

N

%

N

%

7-28 > 28

8 1

80,00 10,00

9 10 2

30,00 33,33 6,66

3 14 -

13,63 63,63 -

6 8 1

33,33 44,44 5,55

3 4 3

15,78 21,05 15,78

Razem

9

90,00

21

70,00

17

77,27

15

83,33

10

52,63

≤6

Tabela 7. Zgony noworodków ELBW, u których wystąpiło krwawienie wewnątrzczaszkowe I i II stopnia Table 6. Death rate in ELBW infants with intracranial hemorrhage of Io and IIo Urodzeniowa masa ciała [g]

Czas zgonu [doby]

500–600

601–700

701–800

801–900

901–1000

N

%

N

%

N

%

N

%

N

%

≤6

-

-

9

30,00

3

13,63

6

33,33

3

15,78

7-28

8

80,00

10

33,33

14

63,63

8

44,44

4

21,05

>28

1

10,00

2

6,66

-

-

1

5,55

3

15,78

Razem

9

90,00

21

70,00

17

77,27

15

83,33

10

52,63

Tabela 8. Śmiertelność noworodków z krwawieniem wewnątrzczaszkowym w zależności od wieku ciążowego Table 7. Death rate in infants with intracranial hemorrhage depending on gestational age Wiek ciążowy [tyg.]

Czas zgonu [doby]

N

%

N

%

N

%

N

%

N

%

N

%

N

%

N

%

N

%

≤6

7

38,89

4

18,18

13

32,50

11

21,15

2

6,66

1

5,88

-

-

-

-

-

-

7-28 > 28

11 -

61,11 -

10 3

45,45 13,63

11 2

27,50 5,00

12 1

23,07 1,92

5 4

16,66 13,33

5 -

29,41 -

2 1

16,66 8,33

-

-

2

15,38

Razem

18

100,00

17

77,27

26

65,00

24

46,15

11

36,66

6

35,29

3

25,00

-

-

2

15,38

≤ 23

24

25

26

U 6 noworodków obserwowano niekorzystną ewolucję krwawienia w postaci poszerzenia się układu komorowego. U wszystkich noworodków były to powikłania po IVH III° (2 przypadki) i IV° (4 przypadki). Noworodki te leczone były powtarzanymi punkcjami lędźwiowymi w celu odbarczenia płynu mózgowo-rdzeniowego. Umieralność noworodków w zależności od urodzeniowej masy ciała oraz rodzaju krwawień do ośrodkowego układu nerwowego przedstawiają tabele 6 i 7.

27

28

29

≥ 31

30

Na podstawie zebranych danych w omawianej grupie noworodków można stwierdzić, że występowanie IVH III i IV stopnia zwiększa ryzyko zgonu. W grupie noworodków z IVH III i IV stopnia stwierdzono 72 zgony, co stanowi 72,73% wszystkich dzieci z nasilonym krwawieniem. Najwyższa umieralność (90%) wystąpiła w grupie dzieci z masą ciała od 500 do 600 g. Różnice te były istotne statystycznie (p = 0,03848).

PRACE ORYGINALNE

256

Katarzyna Plagens-Rotman i inni

Niższa była umieralność noworodków z krwawieniami I i II stopnia. W tej grupie zmarło 35 (30,70%) dzieci (Tabela 7) (p = 0,787). Umieralność noworodków z krwawieniami wewnątrzczaszkowymi jest odwrotnie proporcjonalna do ich dojrzałości (Tabela 8) (p = 0,01579). Dyskusja Noworodki urodzone z ekstremalnie małą urodzeniową masą ciała stanowią około 0,6–1% wszystkich żywo urodzonych noworodków. Populacja noworodków z ELBW urodzonych w Katedrze Neonatologii UM w Poznaniu w okresie od 1 stycznia 2002 do 31 grudnia 2005 wyniosła 383, co stanowiło 1,63% wszystkich żywo urodzonych dzieci. Podobna była liczba żywo urodzonych noworodków z masą ciała poniżej 1000 g w latach 1999–2000 (1,7%) [8]. Wyższy odsetek skrajnego wcześniactwa w badanym materiale wynika prawdopodobnie z faktu, że Ginekologiczno-Położniczy Szpital Kliniczny Uniwersytetu Medycznego, w którym mieści się Katedra Neonatologii, stanowi ośrodek referencyjny III poziomu dla województwa wielkopolskiego i lubuskiego i przyjmuje pacjentki z zagrażającym porodem przedwczesnym z całego regionu. W województwie opolskim w 2003 roku odsetek ten stanowił 0,32%, natomiast wśród dzieci urodzonych w Szpitalu Ginekologiczno-Położniczym i Noworodków w Opolu wynosił 0,58% [9]. Duże znaczenie w zmniejszeniu częstości porodów przedwczesnych odegrały programy profilaktyczne. Jednym z nich jest Krajowy Program Opieki Perinatalnej, który został początkowo wprowadzony w wybranych regionach, a następnie rozpowszechniony w całym kraju, w tym również w województwie opolskim. Celem programu było kompleksowe wdrożenie zmian organizacyjno-strukturalnych opieki perinatalnej dla poprawy wskaźników wysokiej umieralności i zachorowalności w okresie okołoporodowym, a zwłaszcza umieralności dzieci z powodu wcześniactwa. Wraz ze wzrostem przeżywalności noworodków urodzonych przedwcześnie wzrasta również liczba powikłań. Najpoważniejszymi zagrożeniami występującymi najczęściej u wcześniaków z ekstremalnie małą urodzeniową masą ciała są krwawienia do warstwy rozrodczej rozprzestrzeniające się do komór mózgu (IVH) oraz niedotlenienie niedokrwienne powodujące leukomalację okołokomorową (PVL). Przyczyną krwawień około- i dokomorowych są zaburzenia krążenia mózgowego. Przyspieszenie lub zwolnienie przepływu krwi w naczyniach mózgowych oraz nagły wzrost ciśnienia żylnego mogą być przyczyną powstawania wylewów. Intensywne leczenie zaburzeń oddychania poprzez zastosowanie wysokich parametrów wentylacji oraz podawanie katecholamin przyczyniają się do zaburzenia autoregulacji krążenia mózgowego [10].

PRACE ORYGINALNE

W warunkach zdrowia prawidłowa perfuzja tkanki mózgowej jest zabezpieczona systemem autoregulacji mózgowej. W zamartwicy krążenie mózgowe podlega biernemu ciśnieniu krwi z przepływem zależnym od ciśnienia systemowego krwi. Niedotlenienie powoduje spadek ciśnienia w układzie sercowo-naczyniowym, spadek rzutu serca, a w rezultacie spadek przepływu w krążeniu mózgowym. Zaburzone procesy energetyczne tkanki mózgowej prowadzą do zaburzeń wodno-elektrolitowych na poziomie komórki mózgowej, kwasicy, obrzęku neuronów i uszkodzenia komórek naczyń mózgowych [11]. W omawianym materiale krwawienia do OUN stwierdzono u 55,61% noworodków z masą ciała poniżej 1000 g. Dane te są porównywalne z danymi z innych ośrodków w Polsce, w których odsetek krwawień okołoi dokomorowych wyniósł od 40 do 88% [12, 13, 14]. Statystyki opracowane w krajach Europy Zachodniej podają częstość występowania krwawień śródczaszkowych wśród noworodków z ELBW rzędu 53–69% [15], co jest zgodne z wynikami uzyskanymi w naszym ośrodku. W badaniach przeprowadzonych w Klinice Neonatologii UM w Poznaniu w 2000 roku krwawienia dokomorowe III i IV stopnia stanowiły 42% ogółu krwawień u noworodków z urodzeniową masą ciała w przedziale 500– 999 g [8]. Niższą częstość występowania IVH u noworodków z masą ciała poniżej 1000 g obserwowano w Lublinie 30% [16]. W badaniach przeprowadzonych w Finlandii wykazano, że u noworodków z ELBW częstość krwawień dokomorowych III i IV stopnia wynosiła 20% [17]. Jednocześnie stwierdzono, iż w ciągu ostatnich 10 lat częstość występowania wszystkich krwawień śródczaszkowych znacznie zmalała [17]. Najważniejszymi czynnikami ryzyka wystąpienia krwawienia do OUN są m.in. zespół zaburzeń oddychania [17], mechaniczna wentylacja [15], niska punktacja w skali Apgar. Wykazano także związek pomiędzy drogą porodu a ryzykiem krwawienia śródczaszkowego u noworodków o małej masie urodzeniowej. Czynnikiem ryzyka wylewów śródczaszkowych jest poród drogą pochwową. Czynnikami ochronnymi są natomiast: poród drogą cięcia cesarskiego, terapia sterydowa stosowana prenatalnie oraz hipotrofia wewnątrzmaciczna [11, 13]. Coraz więcej publikacji potwierdza również związek pomiędzy zakażeniem wewnątrzmacicznym a występowaniem IVH. Wydaje się obecnie, że współistnienie zakażenia wewnątrzmacicznego w przypadku wystąpienia porodu przedwczesnego jest jednym z najistotniejszych czynników ryzyka powstawania prenatalnych wylewów [10]. Częstym powikłaniem krwawień wewnątrzczaszkowych jest leukomalacja okołokomorowa oraz wodogłowie pokrwotoczne.

Krwawienia wewnątrzczaszkowe u noworodków z ekstremalnie małą urodzeniową masą ciała

W badanej grupie noworodków z ELBW leukomalację okołokomorową rozpoznano u 27 dzieci, co stanowi 7,05%. Badania przeprowadzone u noworodków przedwcześnie urodzonych z masą ciała poniżej 1500 g, przebywających w OITN w Szpitalu Specjalistycznym w Gdańsku w latach 2000–2002, wykazały, że PVL występowało również u dzieci bez krwawienia wewnątrzczaszkowego. Leukomalacja wystąpiła u 59% dzieci z IVH III i IV stopnia, a częstość PVL u dzieci bez cech krwawienia lub z krwawieniem I stopnia wynosiła 8,4% [11]. W badanej przez nas grupie dzieci z IVH III i IV stopnia wodogłowie pokrwotoczne wystąpiło u 6 noworodków, co stanowi 2,81% omawianej populacji. W analizowanym materiale stwierdzono statystycznie istotną zależność pomiędzy przeżyciem noworodka a stopniem krwawienia do ośrodkowego układu nerwowego. Umieralność wśród dzieci z IVH III° i IV° łącznie wyniosła 72,73%. Spośród noworodków z IVH urodzonych w 23. tygodniu ciąży zmarły wszystkie, natomiast śmiertelność w grupie dzieci urodzonych w 24. tygodniu ciąży wynosiła 77,27%. Dla porównania w 28. tygodniu ciąży śmiertelność noworodków wynosiła 35,29%. W analizowanym materiale znaleziono istotną statystycznie zależność pomiędzy obecnością IVH, a wiekiem płodowym oraz hipotrofią wewnątrzmaciczną. Wnioski Analiza zebranych materiałów pozwoliła na sformułowanie następujących wniosków: 1. Częstość występowania krwawień do OUN wśród noworodków urodzonych z masą ciała poniżej 1000 g wyniosła 55,61% i jest porównywalna z danymi z piśmiennictwa krajowego. 2. Częstość krwawień oraz stopień ich nasilenia zależą od wieku ciążowego noworodka. 3. Na krwawienia do OUN III i IV stopnia narażone są noworodki z masą ciała poniżej 800 g. Piśmiennictwo 1. Rutkowska M.: Seminaria z Medycyny Perinatalnej. Ośrodek Wydawnictw Naukowych, Poznań 2003, 8, 9-11. 2. Słomko Z., Bręborowicz G.H., Gadzinowski J. (red.:): II Kongres Polskiego Towarzystwa Medycyny Perinatalnej. OWN 1998, 10-12. 3. Szczapa J.: Noworodek z ekstremalnie małą urodzeniową masą ciała. Klinika Pediatryczna, 1998, 5, 85-91. 4. Szczapa J., Wróblewska-Seniuk K.: Noworodek z ekstremalnie małą urodzeniową masą ciała – aktualny problem kliniczny w neonatologii. Klinika Pediatryczna, 2003, 11, 83-88.

257

5. Szczapa J., Mazela J., Kornacka M., Andrzejewska R.: Zapobieganie krwawieniom około- i dokomorowym u noworodków. Postępy w neonatologii, 1993, 4, 200. 6. Szczapa J.: Neonatologia. Warszawa PZWL 2000. 7. Gadzinowski J., Szymankiewicz M.: Podstawy neonatologii. Poznań 2006. 8. Pietrzycka D., Szymankiewicz M., Gadzinowski J.: Śmiertelność w grupie noworodków z bardzo małą urodzeniową masą ciała. Postępy w neonatologii, 2003, Supl 3, 32-35. 9. Hamuda M., Kowalczykiewicz-Kuta A.: Przeżywalność noworodków urodzonych przedwcześnie z masą ciała poniżej 1500 g w województwie opolskim w latach 1998– 2003. Nowa Pediatria, 2006, 1, 27-31. 10. Ejmocka-Ambroziak A., Kociszewska-Najman B.: Krwawienia do ośrodkowego układu nerwowego u noworodków przedwcześnie urodzonych. Nowa Medycyna, 2000, 8. 11. Krzysztofowicz A., Pilarczyk E., Mrozińska M.: Występowanie krwawień do ośrodkowego układu nerwowego u wcześniaków urodzonych z masą ciała poniżej 1500 g przebywających w Oddziale Intensywnej Terapii i Patologii Noworodka w Szpitalu Specjalistycznym w Gdańsku w latach 2000–2002. Postępy w neonatologii, 2003, supl. 3, 115-120. 12. Kurylak A. i wsp.: Krwawienia śródczaszkowe u noworodków w obrazie ultrasonograficznym – czynniki ryzyka a stopień nasilenia krwawienia. Pediatria Polska, 1998, 73(3), 199-203. 13. Suchońska B. i wsp.: Porody przedwczesne noworodków ze skrajnie niską masą urodzeniową ciała – analiza przebiegu ciąży, porodu oraz stanu pourodzeniowego noworodka. Ginekologia Polska, 2001, 72(12), 1127-1129. 14. Grabowska Z. i wsp.: Wczesna diagnostyka krwawień doi okołokomorowych u noworodków urodzonych przedwcześnie oraz dynamika zmian w obrazie USG głowy w ciągu 1 roku życia. Klinika Perinatologii Ginekologicznej, 1998, 27, Materiały II Kongresu PTMP (3), 253-256. 15. Mancini M.C., Barbosa N.E., Banwart D. i wsp.: Intraventricular hemorrhage in very low birth weight infants: associated risk factors and outcome in the neonatal period. Rev. Hosp. Clin. Fac Med. Sao Paulo, 1999, 54 (5), 151154. 16. Szponar E. i wsp.: Częstość występowania wybranych problemów klinicznych u noworodków z bardzo małą urodzeniową masą ciała hospitalizowanych w Dziecięcym Szpitalu Klinicznym w Lublinie. Postępy neonatologii, 2003, Supl. 1, 22-26. 17. Tommiska V., Heinonen K., Ikonenen S. i wsp.: A national shortterm follow-up study of extremely low birth weight infants born in Finland in 1996–1997. Pediatrics, 2001, 107, 1, 164-65. Adres do korespondencji: Katarzyna Plagens-Rotman Klinika Położnictwa i Chorób Kobiecych Ginekologiczno-Położniczy Szpital Kliniczny UMP w Poznaniu ul. Polna 33 60-535 Poznań

PRACE ORYGINALNE

Nowiny Lekarskie 2011, 80, 4, 258–265

PAWEŁ SACHA1, PIOTR WIECZOREK1, DOMINIKA OJDANA1, SŁAWOMIR CZABAN2, DOROTA OLSZAŃSKA3, ELŻBIETA TRYNISZEWSKA1, 3

OPORNOŚĆ SZCZEPÓW PSEUDOMONAS AERUGINOSA NA KARBAPENEMY PO INKUBACJI Z SUBINHIBICYJNYMI STĘŻENIAMI IMIPENEMU I MEROPENEMU RESISTANCE OF PSEUDOMONAS AERUGINOSA TO CARBAPENEMS AFTER INCUBATION WITH SUBINHIBITORY CONCENTRATIONS OF IMIPENEM AND MEROPENEM 1

Zakład Diagnostyki Mikrobiologicznej i Immunologii Infekcyjnej Uniwersytet Medyczny w Białymstoku Kierownik: prof. dr hab. Elżbieta Tryniszewska 2 Zakład Anestezjologii i Intensywnej Terapii Uniwersytet Medyczny w Białymstoku Kierownik: dr n. med. Sławomir Lech Czaban 3 Zakład Diagnostyki Mikrobiologicznej i Immunologii Infekcyjnej Uniwersytecki Szpital Kliniczny w Białymstoku Kierownik: prof. dr hab. Elżbieta Tryniszewska

Streszczenie Wstęp. Antybiotyki z grupy karbapenemów coraz częściej są stosowane u pacjentów szpitalnych. Imipenem i meropenem jako leki oporne na większość ß-laktamaz mają zastosowanie w leczeniu zakażeń spowodowanych przez pałeczki Gram-ujemne wytwarzające ß-laktamazy o szerokim spektrum (ESBL). Tego typu postępowanie terapeutyczne przyczynia się do selekcji szczepów opornych. Cel. Celem badań jest analiza oporności szczepów Pseudomonas aeruginosa po inkubacji z subinhibicyjnymi stężeniami imipenemu i meropenemu. Materiał i metodyka. W badaniach wykorzystano 20 szczepów Pseudomonas aeruginosa (10 szczepów wrażliwych i 10 opornych na imipenem i meropenem). W pierwszym etapie zbadano występowanie różnych mechanizmów oporności (AmpC, MBL, czynne usuwanie leku z komórki) i określono wartości MIC (początkowe) dla imipenemu i meropenemu. W kolejnym etapie prowadzono przez 72 i 120 godziny indukcję subinhibicyjnymi (½ MIC i ¼ MIC) stężeniami badanych antybiotyków i ponownie oceniano wartości MIC wszystkich badanych szczepów. Wyniki. Szczepy oporne na meropenem i imipenem wykazywały istotny statystycznie wzrost oporności w wyniku hodowli z subinhibicyjnymi stężeniami imipenemu. Najwyższy wzrost wartości MIC zaobserwowano po indukcji stężeniem ½ MIC impenemu przez 120 godziny szczepów pierwotnie opornych. Z kolei meropenem indukował wzrost oporności jedynie u 4 szczepów (Psa 02, Psa 11, Psa 35 i Psa 42). Wnioski. Subinhibicyjne stężenia imipenemu silniej niż meropenem indukowały oporność pałeczek Pseudomonas aeruginosa. Istotny statystycznie wzrost wartości MIC występował w obu badanych grupach szczepów Pseudomonas aeruginosa po 120-godzinnej inkubacji ze stężeniami o wartościach ½ MIC badanych leków. SŁOWA KLUCZOWE: indukcja, oporność, Pseudomonas aeruginosa, imipenem, meropenem.

Summary Introduction. Carbapenem antibiotics are more often used in hospitalized patients. Imipenem and meropenem as drugs resistant to most beta-lactamases are applicable in the treatment of infections caused by Gram-negative bacilli which produce broad spectrum beta-lactamase (ESBL). This type of therapeutic treatment contributes to selection of resistant strains. Aim. The aim of this study is to analyze resistance of Pseudomonas aeruginosa after incubation with subinhibitory concentrations of imipenem and meropenem. Method and material. The study used 20 strains of Pseudomonas aeruginosa (10 strains susceptible and 10 resistant to imipenem and meropenem). In the first phase we examined the occurrence of different mechanisms of resistance (AmpC, MBL, active removal of the drug from the cell) and determined the MIC values (initial) for imipenem and meropenem. The next stage was carried out after 72 and 120 hour induction with subinhibitory (½ and ¼ MIC) concentrations of the antibiotics tested and involved re-evaluation of MICs of all tested strains. Results. Strains resistant to meropenem and imipenem showed a statistically significant increase of resistance as a result of culture with subinhibitory concentrations of imipenem. The highest increase in MIC values was observed in strains initially resistant after induction concentration of ½ MIC impenem for 120 hours. Meropenem induced resistance increase in only 4 strains (Psa 02, Psa 11, Psa 35 i Psa 42). Conclusion. Subinhibitory concentrations of imipenem are stronger than meropenem in induction of resistance in Pseudomonas aeruginosa. Statistically significant increase of MIC values occurred in both groups of Pseudomonas aeruginosa strains after 120 hours of incubation with concentrations of ½ MIC values of tested drugs. KEY WORDS: induction, resistance, Pseudomonas aeruginosa, imipenem, meropenem.

PRACE ORYGINALNE

Oporność szczepów Pseudomonas aeruginosa na karbapenemy po inkubacji z subinhibicyjnymi …

Wstęp Bardzo często w praktyce klinicznej do leczenia zakażeń wywołanych przez pałeczki Gram-ujemne z rodziny Enterobacteriaceae, stosowane są cefalosporyny III generacji. Z kolei w przypadku szczepów wytwarzających ß-laktamazy o rozszerzonym spektrum substratowym (ESBL) oraz pałeczek Pseudomonas aeruginosa są to antybiotyki z grupy karbapenemów – imipenem i meropenem. Tego typu postępowanie terapeutyczne sprzyja kolonizacji środowiska szpitalnego przez szczepy wielooporne. Przyczyną występowania w środowisku szpitalnym szczepów Pseudomonas aeruginosa jest również ich naturalna oporność na szereg grup antybiotyków [1–3]. W związku ze stosowaniem karbapenemów w leczeniu pacjentów szpitalnych istnieje uzasadniona obawa dotycząca możliwości indukowania oporności i rozprzestrzeniania się tej cechy wśród szczepów Pseudomonas aeruginosa pierwotnie wrażliwych na imipenem i/lub meropenem. Cel Celem pracy była ocena oporności wśród szczepów Pseudomonas aeruginosa pierwotnie wrażliwych lub opornych na imipenem i meropenem po indukcji subinhibicyjnymi stężeniami tych leków. Materiał i metody

Szczepy bakteryjne Do badań związanych z indukcją oporności przez imipenem i meropenem wybrano 20 szczepów Pseudomonas aeruginosa (10 wrażliwych oraz 10 opornych). Szczepy identyfikowano z zastosowaniem kart GNI i systemu VITEK (bioMérieux) postępując zgodnie z instrukcją producenta. Wszystkie szczepy izolowano z materiałów otrzymanych z oddziału intensywnej opieki medycznej Uniwersyteckiego Szpitala Klinicznego w Białymstoku. Do kontroli prowadzonych badań stosowano szczepy wzorcowe: ATCC 27853 Pseudomonas aeruginosa, ATCC 25922 Escherichia coli, ATCC 35218 Escherichia coli. Antybiotyki Do indukowania oporności „in vitro” na karbapenemy oraz oznaczania wartości MIC (najmniejsze stężenie hamujące wzrost bakterii; mg/L) zastosowano preparaty handlowe do stosowania dożylnego zawierające imipenem (Thienam; Merc&Co., Inc.) i meropenem (Meronem; AstraZeneca). Badanie wrażliwości na antybiotyki metodą krążkowodyfuzyjną Badania wrażliwości na antybiotyki Pseudomonas aeruginosa przeprowadzono na podłożu agarowym Mueller-Hintona (Oxoid), z zastosowaniem krążków bibułowych (BD BBL) z następującymi antybiotykami: tikarcylina, tikarcylina/kwas klawulanowy, piperacylina, piperacylina/tazobaktam, ceftazydym, cefepim, aztreonam, gentamycyna, netilmycyna, amikacyna, tobramycyna, cipro-

259

floksacyna, imipenem, meropenem. Badania wykonano postępując zgodnie z zaleceniami CLSI [4].

Oznaczanie wartości MIC (mg/L) imipenemu i meropenemu z zastosowaniem metody mikrorozcieńczeniowej w bulionie Mueller-Hintona wśród szczepów poddanych indukcji Z hodowli Pseudomonas aeruginosa na agarze Mueller-Hintona bez antybiotyków i zawierającym różne stężenia subinhibicyjne (½ MIC, ¼ MIC) imipenemu lub meropenemu sporządzano zawiesinę bakterii w bulionie Mueller-Hintona (Oxoid) o gęstości 0,5 w skali MacFarlanda (~108 cfu/ml). Następnie rozcieńczano ją w stosunku 1:100 w bulionie Mueller-Hintona, uzyskując zawiesinę o gęstości 105 cfu/ml, którą stosowano do oznaczania wartości MIC (imipenem i meropenem) badanych szczepów przed i po indukcji badanymi antybiotykami. Badania dotyczące oznaczania wartości MIC wykonywano w jałowych płytkach titracyjnych (typu U) zgodnie z metodyką i zaleceniami NCCLS/CLSI [5]. Indukowanie „in vitro” oporności na karbapenemy z zastosowaniem subinhibicyjnych stężeń (½ MIC i ¼ MIC) imipenemu i meropenemu. W pierwszym etapie, przed indukowaniem oporności, wszystkim wybranym szczepom oznaczono wartość początkową MIC (pierwotną) imipenemu (MICIMP/P) i meropenemu (MICMEM/P). Do indukowania oporności wykorzystano podłoża z agarem Mueller-Hintona zawierające subinhibicyjne stężenia imipenemu lub meropenemu (½ i ¼ MIC badanych szczepów). Do przygotowania tych podłóż wykorzystano preparaty handlowe imipenemu (Thienam; Merc&Co.Inc.) i meropenemu (Meronem; AstraZeneca). Przed przystąpieniem do badań związanych z indukowaniem oporności szczepy hodowano 18 godzin w bulionie Mueller-Hintona, w temperaturze 35°C. Następnie na środek płytki z odpowiednim agarem MuellerHintona nanoszono 100 μl zawiesiny (o gęstości ~108 cfu/ml) badanego szczepu w bulionie Mueller-Hintona. Każdy z badanych szczepów posiewano każdorazowo w 2 seriach na 5 płytkach Petriego zawierających agar Mueller-Hintona z imipenem (w stężeniu ½ MIC – 1 płytka, ¼ MIC – 1 płytka), agar Mueller-Hintona z meropenemem (w stężeniu ½ MIC – 1 płytka, ¼ MIC – 1 płytka) oraz agar Mueller-Hintona bez antybiotyków (1 płytka). Szczepy po 24-godzinnej hodowli pasażowano na świeże podłoża według powyżej opisanego schematu. Pasaże wykonywano przez kolejne 4 doby (przesiew po 24 godzinach inkubacji). Po 72 i 120 godzinach hodowli dokonywano oznaczenia wartości MIC indukowanych szczepów z zastosowaniem metody mikrorozcieńczeniowej. Po zakończeniu badań wszystkie szczepy indukowane przez 120 godziny subinhbicyjnymi stężeniami (½ i ¼ MIC) imipenemu i meropenemu pasażowano 3-krotnie po 24 godziny hodowli na podłożu Mueller-Hintona bez antybiotyku i po ostatnim pasażu oznaczano wartość MIC imipenemu i meropenemu.

PRACE ORYGINALNE

260

Paweł Sacha i inni

Wykrywanie mechanizmów oporności Obecność wytwarzania cefalosporynazy (AmpC) badano z zastosowaniem metody opisanej przez Black i wsp. [6]. Zdolność wytwarzania metalobetalaktamaz (MBLs) oceniano z zastosowaniem E-testów (IP/IPI; AB Biodisk) w oparciu o kryteria producenta E-testów. W badaniach dotyczących wykrywania mechanizmu czynnego usuwania antybiotyku z komórki wykorzystano PaβN (Phe-Arg-β-naphthylamide; Sigma), inhibitor tego mechanizmu. Zawiesinę szczepów (0,5 w skali MacFarlanda) opornych na imipenem i meropenem posiewano jałową wymazówką na agarze Mueller-Hintona oraz agarze Mueller-Hintona zawierającym w swoim składzie PaβN w stężeniu 50 mg/L [7]. Następnie na powierzchni obu podłóż umieszczano krążki zawierające imipenem, meropenem oraz ciprofloksacynę. Po 18-godzinnej inkubacji dokonywano pomiaru stref zahamowania wzrostu dookoła krążków z antybiotykami na agarze Mueller-Hintona z PaβN i agarze Mueller-Hintona bez PaβN i porównywano wyniki pomiaru tych stref obliczając różnicę. Za wynik dodatni badania przyjęto różnicę w wielkości stref zahamowania wzrostu na agarze MuellerHintona z PaβN i agarze Mueller-Hintona bez PaβN, wynoszącą ≥ 5 mm. Ocena statystyczna W analizie statystycznej, porównując niezależne zmienne porządkowe, zastosowano nieparametryczny test U Manna-Whitneya w przypadku dwóch grup. Porównując zmienne zależne wykorzystano test kolejności par Wilcoxona dla dwóch zmiennych. Wyniki istotne statystycznie uznano na poziomie p < 0,05. W obliczeniach wykorzystano pakiet Statistica 8.0 (StatSoft; Polska) Wyniki Wrażliwość na antybiotyki szczepów Pseudomonas aeruginosa wybranych do badań indukowania oporności przez imipenem i meropenem przedstawiono na rycinie 1. W grupie szczepów opornych na karbapenemy (Rycina 1A) aż 90% szczepów było opornych na antybiotyki aminoglikozydowe, ciprofloksacynę, piperacylinę i tikarcylinę (także w połączeniu z inhibitorami β-laktamaz). Z kolei szczepy wrażliwe na karbapenemy (Rycina 1B) były w 100% wrażliwe na cefepim. Najwyższą oporność obserwowano wobec ciprofloksacyny – 40% szczepów opornych. Przeprowadzone badania dotyczące wytwarzania metalo-β-laktamaz (z zastosowaniem E-testów) i/lub obecności mechanizmu czynnego usuwania karbapenemów z komórki (z zastosowaniem inhibitora – PaβN) nie potwierdziły udziału tych mechanizmów w oporności wybranych do badań szczepów na imipenem i meropenem. Zastosowanie krążka z ciprofloksacyną pozwoliło wykazać obecność mechanizmu czynnego usuwania fluorochinolonów u 69,2% (9/13) szczepów opornych

PRACE ORYGINALNE

na ten antybiotyk. Ponadto u 80% szczepów opornych i 40% szczepów wrażliwych na karbapenemy wykazano zdolność wytwarzania cefalosporynazy typu AmpC. W tabelach 1 i 2 przedstawiono wyniki dotyczące uzyskanych wartości MIC szczepów Pseudomonas aeruginosa przed i po inkubacji (72 i 120 godzin) z subinhibicyjnymi (½ MIC i ¼ MIC) stężeniami imipenemu lub meropenemu. Szczepy oporne na meropenem i imipenem (Tabela 1) wykazywały silną tendencję do ekspresji oporności w wyniku hodowli z subinhibicyjnymi stężeniami imipenemu. Aż u 9 z 10 szczepów poddanych indukowaniu różnymi stężeniami imipenemu wykazano wzrost wartości MIC imipenemu po 120 godzinach indukcji. Z kolei meropenem indukował wzrost oporności jedynie u 4 szczepów (Psa 02, Psa 11, Psa 35 i Psa 42). W przypadku szczepów pierwotnie wrażliwych (Tabela 2) tylko u jednego szczepu (Psa 40) stwierdzono po 120 godzinach inkubacji istotną zmianę oporności na imipenem (szczep wrażliwy; MIC = 4 mg/L Æ16 mg/L; szczep oporny). Ten sam szczep wykazywał również zmiany w oporności na meropenem (MIC= 2 mg/L Æ 4 mg/L). Zmiany oporności na meropenem nie były na tyle silnie wyrażone, ażeby zakwalifikować ten szczep jako klinicznie oporny na meropenem. Z kolei inny szczep Pseudomonas aeruginosa (Psa 72), pomimo iż prezentował po indukcji silniejszą ekspresję oporności związaną z tolerancją wyższych stężeń imipenemu (MIC= 0,125 mg/L Æ1 mg/L), również nie kwalifikował się jako oporny na ten lek. Żaden z pierwotnie wrażliwych na oba karbapenemy szczepów po indukcji ze stężeniem ¼ MIC meropenemu nie zmienił poziomu (MIC) pierwotnej oporności na meropenem (Tabela 2). Na rycinie 2 i 3 przedstawiono zmiany wartości MIC (wielokrotność) badanych szczepów Pseudomonas aeruginosa pierwotnie opornych (Rycina 2) i wrażliwych (Rycina 3) na karbapenemy. Najwyższy wzrost wartości MIC zaobserwowano po indukcji stężeniem ½ MIC impenemu przez 120 godziny szczepów pierwotnie opornych (Rycina 2A). U 50% badanych szczepów zaobserwowano 2-krotny i u 20% – 4-krotny i 8-krotny wzrost wartości MIC. Nie zaobserwowano zmian wartości MIC po indukcji stężeniem o wartości ¼ MIC meropenem przez 72 godziny w grupie szczepów opornych (Rycina 2B) i wrażliwych (Rycina 3B) na meropenem. Przedłużenie procesu indukcji do 120 godzin tym antybiotykiem (Rycina 2B) spowodowało 2-krotny wzrost wartości MIC u 20% badanych szczepów. Najsilniejszy efekt ekspresji oporności wśród wszystkich użytych w badaniach szczepów Pseudomonas aeruginosa, stwierdzono po zastosowaniu przez 120 godziny subinhibicyjnych stężeń o wartościach ½ MIC imipenemu. U 90% szczepów pierwotnie opornych (Rycina 2A) i 70% szczepów pierwotnie wrażliwych (Rycina 3A) wykazano istotny wzrost oporności na imipenem. Znacznie słabszy efekt indukcyjny obserwowano stosując indukcję stężeniami o wartościach ½ i ¼ MIC meropenemu. Tylko u 40% pierwotnie opornych i 30% wrażliwych szczepów obser-

Oporność szczepów Pseudomonas aeruginosa na karbapenemy po inkubacji z subinhibicyjnymi …

wowano niewielki wzrost wartości MIC (2-krotny lub 4krotny) meropenemu (Rycina 2B i 3B). Wykonane po zakończeniu badań 3-krotne pasaże (72 godziny) szczepów na podłożu Mueller-Hintona bez antybiotyku i oznaczenia wartości MIC imipenemu

261

i meropenemu wykazały, że wartości MIC po pasażach na podłożach bez antybiotyków odpowiadają takim samym wartościom MIC jak po 120-godzinnej hodowli szczepów indukowanych subinhibicyjnymi stężeniami (½ lub ¼ MIC karbapenemów).

Ciprofloksacyna Tobramycyna Amikacyna Netilmycyna Gentamycyna Aztreonam Cefepim Ceftazydym Piperacylina/tazobaktam Piperacylina Tikarcylina/kwas klawulanowy Tikarcylina 0%

10%

20%

30%

Szczepy wrażliwe

40%

50%

60%

70%

Szczepy średniowrażliwe

80%

90%

100%

Szczepy oporne

A. Szczepy Pseudomonas aeruginosa pierwotnie oporne na imipenem i meropenem

Ciprofloksacyna Tobramycyna Amikacyna Netilmycyna Gentamycyna Aztreonam Cefepim Ceftazydym Piperacylina/tazobaktam Piperacylina Tikarcylina/kwas klawulanowy Tikarcylina 0%

10%

20%

Szczepy wrażliwe

30%

40%

50%

60%

Szczepy średniowrażliwe

70%

80%

90%

100%

Szczepy oporne

B. Szczepy Pseudomonas aeruginosa pierwotnie wrażliwe na imipenem i meropenem Rycina 1. Porównanie wrażliwości na antybiotyki szczepów Pseudomonas aeruginosa pierwotnie opornych (A) lub wrażliwych (B) na imipenem i meropenem Figure 1. Antibiotic susceptibility of Pseudomonas aeruginosa strains initially resistant (A) or susceptible (B) to imipenem and meropenem

PRACE ORYGINALNE

262

Paweł Sacha i inni

Tabela 1. Wartości MIC (mg/L) szczepów Pseudomonas aeruginosa pierwotnie opornych na imipenem i meropenem po inkubacji z subinhibicyjnymi stężeniami tych leków Table 1. MIC values (mg/L) of Pseudomonas aeruginosa strains initially resistant to imipenem and meropenem after incubation with subinhibitory concentrations of these drugs MICT (mg/L) Szczep

½ MICIMP/P MICIMP/P

120 godz. 32

¼ MICIMP/P 72 godz. 16

120 godz. 16

½ MICMEM/P MICMEM/P

¼ MICMEM/P

16

72 godz. 16

120 godz. 16

72 godz. 16

120 godz. 16

Psa 01

16

72 godz. 16

Psa 02

16

32

64

16

32

16

32

32

16

32

Psa 11

16

32

128

32

32

32

32

64

32

32

Psa 13

16

32

64

32

32

16

16

16

16

16

Psa 35

16

32

128

32

32

32

64

64

32

64

Psa 39

16

32

32

16

16

16

16

16

16

16

Psa 42

32

32

64

32

32

16

16

32

16

16

Psa 46

16

16

32

16

16

16

16

16

16

16

Psa 47

16

32

32

16

16

16

16

16

16

16

Psa 50

32

32

32

32

32

32

32

32

32

32

Objaśnienia: MICT – wartości MIC (mg/L) imipenemu lub meropenemu oznaczone po 72- lub 120-godzinnej indukcji z subinhibicyjnymi stężeniami tych antybiotyków, MICIMP/P – wartość początkowa MIC (mg/L) imipenemu oznaczona dla szczepów przed indukcją, ½ MICIMP/P, ¼ MICIMP/P – subinhibicyjne stężenia imipenemu stosowane do indukcji oporności, MICMEM/P – wartość początkowa MIC (mg/L) meropenemu oznaczona dla szczepów przed indukcją, ½ MICMEM/P, ¼ MICMEM/P – subinhibicyjne stężenia meropenemu stosowane do indukcji oporności.

Tabela 2. Wartości MIC (mg/L) szczepów Pseudomonas aeruginosa pierwotnie wrażliwych na imipenem i meropenem po inkubacji z subinhibicyjnymi stężeniami tych leków Table 2. MIC values (mg/L) of Pseudomonas aeruginosa strains initially susceptible to imipenem and meropenem after incubation with subinhibitory concentrations of these drugs MICT (mg/L) Szczep

½ MICIMP

¼ MICIMP

MICIMP/P

½ MICMEM

¼ MICMEM

MICMEM/P 72h

120h

72h

120h

4

8

4

4

72h

120h

72h

120h

0,125

0,125

0,125

0,125

0,125

Psa 03

4

Psa 29

4

4

4

4

4

0,5

0,5

0,5

0,5

0,5

Psa 34

2

2

4

2

2

2

2

4

2

2

Psa 40

4

4

16

4

8

2

4

4

2

2

Psa 41

1

1

1

1

1

0,250

0,5

1

0,250

0,250

Psa 43

0,5

2

2

1

1

0,125

0,125

0,125

0,125

0,125

Psa 72

0,125

1

1

0,125

0,125

0,125

0,125

0,125

0,125

0,125

Psa 93

1

1

1

1

1

0,5

0,5

0,5

0,5

0,5

Psa 110

0,5

0,5

1

0,5

1

2

2

2

2

2

Psa 118

0,5

1

1

0,5

0,5

4

4

4

4

4

Objaśnienia: MICT – wartości MIC (mg/L) imipenemu lub meropenemu oznaczone po 72- lub 120-godzinnej indukcji z subinhibicyjnymi stężeniami tych antybiotyków, MICIMP/P – wartość początkowa MIC (mg/L) imipenemu oznaczona dla szczepów przed indukcją, ½ MICIMP/P, ¼ MICIMP/P – subinhibicyjne stężenia imipenemu stosowane do indukcji oporności, MICMEM/P – wartość początkowa MIC (mg/L) meropenemu oznaczona dla szczepów przed indukcją, ½ MICMEM/P, ¼ MICMEM/P – subinhibicyjne stężenia meropenemu stosowane do indukcji oporności.

PRACE ORYGINALNE

Oporność szczepów Pseudomonas aeruginosa na karbapenemy po inkubacji z subinhibicyjnymi …

100%

263

szczepów

90% 80% 70% 60% 50% 40% 30% 20% 10% 0% 72 godz.

120 godz.

72 godz.

½ MIC MIC (bez zmian)

A.

100%

120 godz. ¼ MIC

2 x MIC

4 x MIC

8 x MIC

MIC imipenem

szczepów

90% 80% 70% 60% 50% 40% 30% 20% 10% 0% 72 godz.

120 godz.

72 godz.

½ MIC

120 godz. ¼ MIC

MIC (bez zmian)

2 x MIC

4 x MIC

8 x MIC

B. MIC meropenem Rycina 2. MIC (wielokrotność) szczepów Pseudomonas aeruginosa pierwotnie opornych na imipenem (A) i meropenem (B) po 72- i 120-godzinnej indukcji subinhibicyjnymi stężeniami tych antybiotyków. Figure 2. MIC (multiplicity) of Pseudomonas aeruginosa strains initially resistant to imipenem (A) and meropenem (B) after 72 and 120 hours of induction with subinhibitory concentrations of these antibiotics.

PRACE ORYGINALNE

264

Paweł Sacha i inni

100%

szczepów

90% 80% 70% 60% 50% 40% 30% 20% 10% 0% 72 godz.

120 godz.

72 godz.

½ MIC

120 godz. ¼ MIC

MIC (bez zmian)

2 x MIC

4 x MIC

8 x MIC

A. MIC imipenem 100%

szczepów

90% 80% 70% 60% 50% 40% 30% 20% 10% 0% 72 godz.

120 godz.

72 godz.

½ MIC

120 godz. ¼ MIC

MIC (bez zmian)

2 x MIC

4 x MIC

8 x MIC

B. MIC meropenem Rycina 3. MIC (wielokrotność) szczepów Pseudomonas aeruginosa pierwotnie wrażliwych na imipenem (C) i meropenem (D) po 72- i 120-godzinnej indukcji subinhibicyjnymi stężeniami tych antybiotyków. Figure 3. MIC (multiplicity) of Pseudomonas aeruginosa strains initially susceptible to imipenem (A) and meropenem (B) after 72 and 120 hours of induction with subinhibitory concentrations of these antibiotics

Dyskusja Obserwowany w ostatnich latach sukcesywny wzrost izolacji z materiałów klinicznych pałeczek Pseudomonas aeruginosa związany jest w dużej mierze z nieracjonalnym stosowaniem leków o szerokim spektrum. Problem ten staje się tym groźniejszy, że brak jest perspektyw wprowadzenia nowych, skutecznych leków do zwalczania zakażeń, za które odpowiedzialne są wielooporne szczepy Pseudomonas aeruginosa. Fakt naturalnej oporności tych bakterii i możliwość „nabywania” oporności na antybiotyki przyczynia się do rozprzestrzeniania takich szczepów w środowisku szpi-

PRACE ORYGINALNE

talnym, co z kolei stwarza olbrzymie problemy w terapii zakażeń [3, 8]. Przeprowadzone w ostatnich latach badania oporności pałeczek Pseudomonas aeruginosa na meropenem i imipenem wykazały niepokojący wzrost oporności na ten antybiotyk [9, 10]. W Polsce badania wykonane przez Patzera i wsp. [11] wykazały występowanie oporności na imipenem u 15% badanych szczepów Pseudomonas aeruginosa. Oporność pałeczek Pseudomonas aeruginosa na antybiotyki (w tym na karbapenemy) może być uwarunkowana przez wiele mechanizmów. Należą do nich utra-

Oporność szczepów Pseudomonas aeruginosa na karbapenemy po inkubacji z subinhibicyjnymi …

ta białek porynowych (OprD), obecność systemów czynnego usuwania leków, modyfikacja receptorów wiążących antybiotyk (PBP3 i PBP4) oraz zdolność wytwarzania β-laktamaz [2, 3, 8]. Bardzo często wśród szczepów Pseudomonas aeruginosa opornych na karbapenemy obserwuje się również oporność na antybiotyki aminoglikozydowe, cefalosporyny, fluorochinolony i połączenia antybiotyków β-laktamowych z inhibitorami β-laktamaz [11, 12]. Potwierdzają to spostrzeżenia wynikające z przeprowadzonych przez nas badań dotyczących oporności na inne antybiotyki (90% szczepów opornych) wśród szczepów opornych na imipenem i meropenem. Uzyskany w badaniach własnych wzrost wartości MIC (od 2- do 8-krotny) oraz potwierdzenie wytwarzania AmpC wskazuje, iż mechanizmem odpowiedzialnym za oporność użytych w badaniach pałeczek Pseudomonas aeruginosa jest prawdopodobnie utrata białek OprD w połączeniu z wytwarzaniem (derepresja) cefalosporynazy AmpC. Powyższe wnioski wynikają z danych literaturowych [13–18] oraz z faktu, iż nie wykazaliśmy w populacji badanych szczepów udziału innych mechanizmów, tj. metalo-β-laktamaz i czynnego usuwania karbapenemów z komórki. Przeprowadzone przez nas badania oporności szczepów (wcześniej indukowanych) po pasażach bez antybiotyków pozostają w dużej zgodności z badaniami Pournarasa i wsp. [12] i pozwalają na postawienie wniosku, że indukcja subinhibicyjnymi stężeniami imipenemu wyzwala trwałą oporność na ten antybiotyk. Podsumowując wyniki naszych badań można stwierdzić, iż nadużywanie w terapii zakażeń szpitalnych imipenemu może być przyczyną narastania oporności wśród szczepów Pseudomonas aeruginosa występujących w środowisku szpitalnym. Wnioski 1. Subinhibicyjne stężenia imipenemu silniej niż meropen indukowały oporność pałeczek Pseudomonas aeruginosa. 2. Istotny statystycznie wzrost wartości MIC występował w obu badanych grupach szczepów Pseudomonas aeruginosa po 120-godzinnej inkubacji ze stężeniami o wartościach ½ MIC badanych leków. Piśmiennictwo 1. Cornaglia G., Hryniewicz W., Jarlier V. et al.: European recommendations for antimicrobial resistance surveillance. Clin. Microbiol. Infect., 2004, 10, 349-383. 2. Kattan J.N., Villegas M.V., Quinn J.P.: New developments in carbapenems. Clin. Microbiol. Infect., 2008, 14, 1102-1111. 3. Strateva T., Yordanov D.: Pseudomonas aeruginosa – a phenomenon of bacterial resistance. J. Med. Microbiol., 2009, 58,1133-1148. 4. Clinical and Laboratory Standards Institute: Performance Standards for Antimicrobial Susceptibility Testing; Seventeenth Informational Supplement: M100-S17. NCCLS 2007, Wayne, PA, USA.

265

5. National Committee for Clinical Laboratory Standards: Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically-Fifth Edition: Approved Standard M7-A5. NCCLS 2000, Wayne, PA, USA. 6. Black J.A., Thomson K.S., Buynak J.D. et al.: Evaluation of β-lactamase inhibitors in disk tests for detection of plasmid-mediated AmpC beta-lactamases in wellcharacterized clinical strains of Klebsiella spp. J. Clin. Microbiol., 2005, 43, 4168-4171. 7. Mesaros N., Glupczynski Y., Avrain L. et al.: A combined phenotypic and genotypic method for the detection of Mex efflux pumps in Pseudomonas aeruginosa. J. Antimicrob. Chemother., 2007, 59, 378-386. 8. Sacha P., Wieczorek P., Hauschild T. et al.: Metallo-betalactamases of Pseudomonas aeruginosa – a novel mechanism resistance to beta-lactam antibiotics. Folia Histochem. Cytobiol.. 2008, 46, 137-42. 9. Lepper P.M., Grusa E., Reichl H. et al.: Consumption of imipenem correlates with β-lactam resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 2002, 46, 2920-2925. 10. Turner P.J.: MYSTIC Europe 2007: activity of meropenem and other broad-spectrum agents against nosocomial isolates. Diagn. Microbiol. Infect. Dis., 2009, 63, 217-222. 11. Patzer J.A, Dzierzanowska D.: Increase of imipenem resistance among Pseudomonas aeruginosa isolates from a Polish paediatric hospital (1993-2002). Int. J. Antimicrob. Agents, 2007, 29, 153-8. 12. Pournaras S., Ikonomidis A., Markogiannakis A. et al.: Characterization of clinical isolates of Pseudomonas aeruginosa heterogeneously resistant to carbapenems. J. Med. Microbiol., 2007, 56, 66-70. 13. Ballestero S., Fernández-Rodríguez A., Villaverde R. et al.: Carbapenem resistance in Pseudomonas aeruginosa from cystic fibrosis patients. J. Antimicrob. Chemother., 1996, 38, 39-45. 14. Farra A., Islam S., Strålfors A. et al.: Role of outer membrane protein OprD and penicillin-binding proteins in resistance of Pseudomonas aeruginosa to imipenem and meropenem. Int. J. Antimicrob. Agents, 2008, 31, 427-33. 15. Köhler T., Michea-Hamzehpour M., Epp S.F. et al.: Carbapenem activities against Pseudomonas aeruginosa: respective contributions of OprD and efflux systems. Antimicrob. Agents Chemother., 1999, 43, 424-427. 16. Pai H., Kim J., Kim J. et al.: Carbapenem resistance mechanisms in Pseudomonas aeruginosa clinical isolates. Antimicrob. Agents Chemother., 2001, 45, 480-484. 17. Tausk F., Evans M.E., Patterson L.S. et al.: Imipeneminduced resistance to antipseudomonal β-lactams in Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 1985, 28, 41-45. 18. Zhou X.Y., Kitzis M.D., Gutmann L.: Role of cephalosporinase in carbapenem resistance of clinical isolates of Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 1993, 37, 1387-1389. Adres do korespondencji: Paweł Sacha Zakład Diagnostyki Mikrobiologicznej i Immunologii Infekcyjnej Uniwersytet Medyczny w Białymstoku ul. Waszyngtona 15A 15-269 Białystok e-mail: [email protected]

PRACE ORYGINALNE

Nowiny Lekarskie 2011, 80, 4, 266–271

MAGDALENA MAGIERSKA-KRZYSZTOŃ1,2, MAŁGORZATA POSŁUSZNA1

ROZWÓJ MOWY I JĘZYKA U DZIECI ZAIMPLANTOWANYCH PRZED TRZECIM ROKIEM ŻYCIA THE DEVELOPMENT OF SPEECH AND LANGUAGE OF CHILDREN WITH COCHLEAR IMPLANTS INTRODUCED BEFORE THIRD YEAR OF LIFE 1 Zakład Edukacji Katedra Nauk o Zdrowiu Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Kierownik: dr n. hum. Mirosława Cylkowska-Nowak 2 Katedra i Klinika Otolaryngologii i Onkologii Laryngologicznej Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Kierownik: prof. dr hab. Witold Szyfter

Streszczenie Cel. Celem pracy jest przedstawienie możliwości rozwoju umiejętności słuchowych i językowych u dzieci z głuchotą prelingwalną, zaimplantowanych wszczepem ślimakowym. Materiał i metody. W badaniach wzięło udział 73 pacjentów, zaimplantowanych przed trzecim rokiem życia. W badaniach wykorzystano logopedyczne narzędzia oceny, które pozwoliły ocenić aktualny poziom rozwoju mowy dźwiękowej oraz umiejętność posługiwania się językiem w sytuacjach życia społecznego. Wyniki. Wyniki uzyskane w grupie dzieci niesłyszących, zaimplantowanych wszczepem ślimakowym przed 3 rokiem życia pokazują, że nabywanie mowy i języka jest procesem długotrwałym, który poprzez realizację spontanicznych oraz terapeutycznie stymulowanych określonych językowych czynności komunikacyjnych nadal podlega rozwojowi. Wnioski. Nabycie kompetencji językowych oraz komunikacyjnych przez badane dzieci z implantem ślimakowym jest możliwe, czego efektem jest czynne posługiwanie się językiem mówionym w życiu społecznym oraz szansa na pełną integrację ze środowiskiem ludzi słyszących. SŁOWA KLUCZOWE: mowa, język, implant ślimakowy.

Summary Aim. The aim of the study is to present the opportunities for development aural and language skills in children with pre-linguistic deafness, implanted with cochlear implants. Method and material. In the studies participated 73 patients, implanted with before third year of life. The studies used the logopedic assessment tools, which allowed to assess the current level of development of sonic speech and skill, the language management in situations of social life. Results. The results obtained in the group of deaf children, implanted with cochlear implant before third years of life, show that acquisition the speech and language is a lengthy process, which through the implementation of the spontaneous and therapeutically stimulated specific language and communication activities is still subject to development. Conclusions. The acquisition of language skills and communication by the target children with cochlear implant is possible, resulting in an active use of the spoken language in social life and a chance to fully integrate with the environment of hearing people. KEY WORDS: speech, language, cochlear implant.

Wstęp Podstawę prawidłowego rozwoju mowy stanowi sprawnie działający słuch. Słuch jest najważniejszym ze zmysłów, jakim natura obdarowała człowieka, ponieważ z możliwością słyszenia łączy się umiejętność mówienia i nawiązywania kontaktu słownego z otoczeniem [1]. Narząd słuchu warunkuje nie tylko słyszenie i rozumienie mowy innych osób, ale także kontrolę mowy własnej. Upośledzenie słuchu ogranicza kontakt człowieka ze środowiskiem i uniemożliwia jego pełny rozwój. Na skutek zaburzeń słuchu dochodzi do nieodwracalnych problemów w sferze percepcji mowy, mówienia i poro-

PRACE ORYGINALNE

zumiewania się, w sferze poznawczej, społecznej, emocjonalnej, intelektualnej. Zaburzenia słuchu stanowią zatem poważny problem w logopedii, gdyż pociągają za sobą zaburzenia mowy. Opanowanie pierwszych umiejętności komunikacyjnych przez dzieci z wadą słuchu wiąże się ściśle z wiekiem, w którym nastąpiło uszkodzenie narządu słuchu. U dzieci z prelingwalną utratą słuchu (gdy uszkodzenie słuchu wystąpiło przed okresem nabycia mowy ustnej) porozumiewanie się za pomocą słów nie wykształca się w ogóle lub kształtuje się w stopniu niewystarczającym dla prawidłowego rozumienia mowy. Istnieje więc konieczność wytworzenia koordynacji między słuchem a motoryką, innymi zmysłami i funkcjami mózgu.

Rozwój mowy i języka u dzieci zaimplantowanych przed trzecim rokiem życia

Dzieci, które mają uszkodzony słuch od urodzenia lub od niemowlęctwa przy braku odpowiednich działań otoczenia mogą w ogóle nie reagować na wrażenia słuchowe i ich nie odróżniać. Tym samym nie przyswajają języka słownego i nie umieją się nim posługiwać. W przypadku braku wczesnej stymulacji słuchowej dochodzi u nich do nieodwracalnych zmian fizjologicznych w odpowiedzialnych za funkcje słuchowe strukturach mózgu. Zaburzenia słuchu powinny być zatem wykrywane jak najwcześniej. Wówczas istnieją najlepsze warunki do postępowania rewalidacyjnego, co w konsekwencji umożliwi dziecku względnie prawidłowy rozwój mowy. Z pewnością wpłynie to także na komunikację z otoczeniem oraz na rozwój życia emocjonalnego, osobowości i uspołecznienie, co w istotny sposób poprawi jakość życia tej grupy dzieci i ich rodzin. Najkorzystniejsze dla dziecka jest wykrycie uszkodzenia i rozpoczęcie oddziaływań naprawczych przed upływem okresu krytycznego dla danej funkcji, czyli okresu maksymalnej podatności dziecka na określone bodźce. Są to pierwsze trzy lata życia dziecka. Jest to czas szczególnie istotny dla rozwoju mowy. W tym okresie zmysłowe doświadczenia dostarczane z zewnątrz znacznie wpływają na układ nerwowy, w tym także na drogi słuchowe. Dziecko 3-letnie potrafi zrozumiale porozumieć się z osobami z otoczenia, chociaż jego mowa wymaga doskonalenia do około 6. roku życia. Dziecko niesłyszące lub niedosłyszące, nie odbierające bodźców z otoczenia, nie będzie mogło wykorzystać swoich możliwości oraz rozwijać umiejętności związanych z rozumieniem i produkcją mowy. Jedną z nowoczesnych technik wykorzystywanych w leczeniu niektórych wad słuchu jest wszczep ślimakowy. Implant ślimakowy to rodzaj elektronicznej protezy słuchowej mającej zastąpić uszkodzony narząd odbiorczy. Jest to bardzo mały, doskonały w konstrukcji i precyzyjny aparat stanowiący ogniwo drogi słuchowej. Implant ślimakowy stosowany jest w przypadkach głębokiego, obustronnego niedosłuchu odbiorczego oraz w sytuacji, gdy brak korzyści ze stosowania aparatów słuchowych [2]. Zadaniem wszczepu jest odbiór dźwięków z otoczenia, zwłaszcza mowy, i poprzez stymulację akustyczno-elektryczną dostarczenie ich do ośrodków słuchowych w centralnym układzie nerwowym, gdzie są one odbierane jako wrażenia słuchowe [3]. Bez implantu słyszenie jest niemożliwe. Po operacji wszczepienia konieczna jest terapia logopedyczno-psychologiczna [4]. Dzieciom z prelingwalnym uszkodzeniem słuchu, u których proces uczenia się mowy i języka jest naprawdę bardzo trudny, wprowadzenie wszczepu ślimakowego daje możność wykrywania, różnicowania, identyfikacji i rozumienia dźwięków mowy. Możliwości percepcji dźwięków za pomocą wszczepu są w większości przypadków bardzo duże. Samo zastosowanie tej techniki nie jest jednak warunkiem wystarczającym do opanowania rozumienia mowy drogą słuchową. Percepcja musi być rozwijana w toku rehabilitacji, której podstawą jest wieloetapowy trening słuchowy, a raczej wychowanie słuchowe,

267

prowadzone w oparciu o dźwięki przedmiotowe, lecz przede wszystkim i jak najszybciej o dźwięki mowy [2]. Pierwszy etap to wykrywanie dźwięków. Jest to możliwość odpowiedzi na obecność lub brak dźwięku. A zatem dziecko uczy się reagować na dźwięk, zwracać na niego uwagę i nie reagować wtedy, gdy go nie ma. W etapie tym dziecko powinno nauczyć się uwarunkowanej odpowiedzi na bodziec dźwiękowy. Następny etap to różnicowanie (dyskryminacja). Jest to możliwość postrzegania podobieństw i różnic pomiędzy dwoma lub więcej bodźcami słuchowymi, zwłaszcza w oparciu o mowę. Dziecko uczy się je dostrzegać i odpowiadać w zróżnicowany sposób na dostarczane dźwięki. Kolejny etap tego modelu to rozpoznawanie (identyfikacja). Jest to możliwość określania poprzez powtórzenie, wskazanie, bądź napisanie usłyszanych dźwięków mowy. Rozpoznawanie to może być oparte zarówno na zjawiskach suprasegmentalnych (prozodycznych), jak i segmentalnych (czyli zestawach głosek tworzących sylaby, wyrazy, zdania). Jest to etap, który zazwyczaj trwa dość długo i zależy od umiejętności terapeuty. Końcowy etap to rozumienie, czyli możliwość rozpoznawania znaczenia mowy poprzez odpowiadanie na pytania, wykonywanie poleceń, uczestniczenie w rozmowie, nawet w niezbyt doskonały sposób. Odpowiedzi dziecka mogą różnić się jakością, ważne jest to, że przekaz słowny został przez nie zrozumiany. W modelu tym ważne jest rozwijanie wszystkich zdolności poznawczych dziecka, kształtowanie jego pomięci słuchowej i tzw. sekwencyjności, czyli utrzymywania w pamięci kilku kolejnych elementów. Może to się odbywać zarówno podczas specjalnie przygotowanych sesji, ale także w spontanicznej zabawie, której może, a właściwie powinna, towarzyszyć rozmowa z dzieckiem. Badania naukowe prowadzone w wielu ośrodkach implantów ślimakowych na całym świecie, także u nas, pokazują, że wiele dzieci przy spełnieniu warunku prawidłowej terapii, jest w stanie rozumieć mowę w zestawach otwartych jedynie drogą słuchową. Fakt ten jest największą wartością tej nowoczesnej metody, spełnieniem niemożliwych dotychczas celów. Materiał i metody W badaniach wzięło udział 73 dzieci z głuchotą prelingwalną, zaimplantowanych wszczepem ślimakowym przed trzecim rokiem życia. Operacje wszczepienia implantu ślimakowego wykonano w Klinice Otolaryngologii i Onkologii Laryngologicznej Uniwersytetu Medycznego im. Karola Marcinkowskiego w Poznaniu. Wszystkie badane dzieci do momentu implantacji użytkowały przez okres minimum sześciu miesięcy aparaty słuchowe. U około 10% pacjentów przed operacją zaobserwowano spontaniczne wokalizacje realizowane poprzez ciągi sylab, nie miały one jednak przełożenia na znaczenie w systemie językowym. U 90% dzieci w badaniu mowy spontanicznej nie występowały żadne formy wokalne, co świadczyło o braku rozwoju mowy w wyniku występującego od urodzenia niedosłuchu.

PRACE ORYGINALNE

268

Magdalena Magierska-Krzysztoń, Małgorzata Posłuszna

cepcji wzorców rytmicznych mowy (Tabela 2). Zdolność do różnicowania dźwięków kształtuje się przeciętnie w ciągu pierwszych sześciu miesięcy użytkowania wszczepu [5]. Odstępstwo w tym zakresie dotyczy tylko dzieci z obniżonym ilorazem inteligencji oraz współistniejącymi dysfunkcjami, które upośledzają prawidłowy rozwój schematów poznawczych. Jednak i ta grupa nabywa umiejętność dyskryminacji dźwięków mowy, potrzebując na to przeciętnie dwóch lat od momentu podłączenia procesora mowy. Wyniki uzyskane w teście TAPS, kategorii III, pokazują, że większość dzieci (ponad 80%), niezależnie od czasu użytkowania wszczepu ślimakowego, dobrze radziła sobie z zadaniami wymagającymi umiejętności percepcji cech mowy oraz identyfikacji mowy (Tabela 3). Zaobserwować można było, że różna liczba sylab w słowach testowych stanowiła istotną wskazówkę, ułatwiającą prawidłową interpretację. Identyfikacja na drodze słuchowej wyrazów o jednakowej liczbie sylab sprawiała więcej trudności badanym. Prawidłowa identy-

Badania prowadzone podczas jednego z etapów kwalifikacji do operacji (pedagogiczne, logopedyczne oraz psychologiczne) wskazywały, że wszyscy badani byli w normie intelektualnej. Dopiero w momencie rozpoczęcia edukacji przedszkolnej u około 15% zaimplantowanych badanych dzieci ujawniły się – współistniejące z niedosłuchem – dysfunkcje rozwojowe w postaci autyzmu wczesnodziecięcego oraz upośledzenia umysłowego w stopniu lekkim. Badana grupa zaimplantowanych przed trzecim rokiem życia dzieci była grupą homogenną, użytkującą wszczep ślimakowy Nucleus firmy Cochlear. Wszyscy badani pochodzili z rodzin, w których posługiwano się na co dzień mową dźwiękową. Pacjenci objęci byli systematyczną terapią surdologopedyczną w odpowiedniej placówce terapeutycznej w miejscu zamieszkania lub na terenie szkoły czy przedszkola, do którego uczęszczali. Czas użytkowania wszczepu ślimakowego równoznaczny z czasem pooperacyjnej rehabilitacji wynosił od minimum pięciu do trzynastu lat (Tabela 1). Tabela 1. Czas użytkowania wszczepu ślimakowego Table 1. Time of cochlear implant use Czas użytkowania wszczepu ślimakowego od 5 do 7 lat od 7 do 10 lat powyżej 10 lat

W badaniach użyto Arkusza Badania Umiejętności Językowych, który powstał w ośrodku poznańskim. Wypracowane standardy badawcze pozwoliły na uzyskanie informacji dotyczących procesu nabywania kompetencji językowych przez pacjentów z wszczepem ślimakowym, z głuchotą prelingwalną. Arkusz badał podstawowe umiejętności językowe w zakresie rozumienia, produkcji mowy, zasobu pojęć oraz sprawności realizacyjnej w obrębie badanych grup głosek języka polskiego. Uzyskane wyniki analizowane były w kontekście wieku fizjologicznego i słuchowego (rozpoczynającego się w momencie implantacji) każdego dziecka. Dodatkowo posłużono się testem TAPS (Test of Auditory Perception of Speech), przetłumaczonym i dostosowanym do warunków języka polskiego w Katedrze Chorób Ucha, Nosa, Gardła i Krtani Uniwersytetu Medycznego w Poznaniu oraz w Zakładzie Fonetyki Akustycznej PAN w Poznaniu. Test sprawdza umiejętność wykrywania, dyskryminacji, identyfikacji oraz rozpoznawania dźwięków mowy w zestawach zamkniętych i otwartych. Wyniki Wszystkie badane dzieci, użytkujące wszczep ślimakowy minimum pięć lat, bezbłędnie wykonują próbę wykrywania fonemów na drodze słuchowej (Tabela 1). Wyniki uzyskane w teście TAPS – poziom II wskazują, że wszyscy badani pacjenci opanowali umiejętność per-

PRACE ORYGINALNE

n

%

43 20 10

58 28 14

fikacja zależy w dużym stopniu od poziomu kompetencji językowych poszczególnych dzieci. Osiągnięcie poziomu rozumienia mowy w zbiorach otwartych okazało się zadaniem trudnym dla około 30% dzieci, tych korzystających ze wszczepu najkrócej w stosunku do reszty badanej grupy (Tabela 4). Dalsze wyniki pokazują, że wszyscy pacjenci użytkujący wszczep ślimakowy powyżej siedmiu lat bardzo dobrze radzą sobie z poszczególnymi zadaniami testowymi, osiągając poziom rozpoznawania mowy w zestawach zamkniętych, a 90% dzieci tej grupy rozumie mowę na drodze słuchowej, ćwicząc na materiale językowym podawanym w zestawach otwartych. Odbiór i interpretacja materiału językowego na tym poziomie testowym wymaga znajomości języka funkcjonalnego we wszystkich jego aspektach: semantycznym, syntaktycznym oraz morfologicznym, co zazwyczaj dostępne jest dzieciom z długim stażem (przynajmniej siedmioletnim) użytkowania implantu. Analiza wyników uzyskanych podczas zastosowania Arkusza Badania Umiejętności Językowych pokazuje jednoznacznie, że dzieci, które użytkują implant najdłużej – powyżej 10 lat – osiągają najwyższe noty we wszystkich badanych sferach (Rycina 1). Osiągnięta umiejętność realizacji prawidłowych wzorców artykulacyjnych wśród większości badanych dzieci, niezależnie od czasu użytkowania wszczepu, jest związana naj-

Rozwój mowy i języka u dzieci zaimplantowanych przed trzecim rokiem życia

269

Tabela 2. Test TAPS, poziom II Table 2. TAPS test, the II level Czas użytkowania implantu od 5 do 7 lat od 7 do 10 lat powyżej 10 lat

n 43 20 10

percepcja wzorców rytm. mowy 100% 100% 100%

Legenda: n- liczba pacjentów

Tabela 3. Test TAPS, poziom III Table 3. TAPS test, the III level Percepcja cech mowy, identyfikacja mowy 70% > 50% 50% <

od 5 do 7 38 3 2

Czas użytkowania wszczepu od 7 do 10 16 4

powyżej 10 10

Tabela 4. Test TAPS, poziom IV Table 4. TAPS test, the IV level Czas użytkowania wszczepu od 5 do 7 od 7 do 10 powyżej 10

70% > 12 15 10

Rozpoznawanie mowy zbiory zamknięte zbiory otwarte 50% 50% < 70% > 50% 15 16 2 10 4 1 15 3 8 2

50% < 31 2

Tabela 5. Arkusz Badania Umiejętności Językowych Table 5. Sheet of the language skills study Umiejętności językowe rozumienie produkcja mowy zasób pojęć artykulacja

od 5 do 7 58% 57% 36% 68%

Czas użytkowania wszczepu od 7 do 10 68% 65% 50% 82%

powyżej 10 79% 68% 60% 88%

Legenda: % – prawidłowych odpowiedzi

prawdopodobniej z oddziaływaniami surdologopedycznymi, których celem było między innymi uzyskanie wyrazistej wymowy, aby stać się zrozumiałym dla otoczenia. Dużą trudność u badanych zaobserwować można było w zadaniach testowych z zakresu produkcji mowy. Skuteczne porozumiewanie się wymaga umiejętności zastosowania adekwatnych do danej sytuacji społecznej zachowań językowych, których użycie związane jest ze zdolnością do posługiwania się określonymi regułami gramatycznymi. Zasób pojęć, którym dysponują zaimplantowane dzieci – szczególnie te z wiekiem słuchowym trwającym do siedmiu lat – jest nieduży. Pozbawienie cech akustycznych charakterystycznych dla otaczających przedmiotów, zwierząt, zdarzeń i ludzi jeszcze przed implantacją, poważnie upośledziła proces nabywania pojęć. Spowodowało to narastanie dalszych

trudności oraz opóźnień w rozwoju mowy, co może mieć związek z nabytym uprzednio mechanizmem nieprawidłowego interpretowania rzeczywistości. Wyniki przeprowadzonych badań pokazują, że dzieci użytkujące wszczep ślimakowy dłużej niż siedem lat uzyskują jednak lepsze postępy w zakresie rozumienia, produkcji mowy, trwałego zasobu pojęć w stosunku do dzieci korzystających z implantu poniżej siedmiu lat. Uzyskane wyniki wskazują, że możliwość długoletniego dostępu do języka mówionego na drodze słuchowej, po zaimplantowaniu w pewnym stopniu daje szansę na ograniczenie bariery fonetycznej [6], z którą dzieci z głuchotą prelingwalną muszą się zmagać z racji swojej niepełnosprawności.

PRACE ORYGINALNE

270

Magdalena Magierska-Krzysztoń, Małgorzata Posłuszna

Dyskusja W przestawionych powyżej wynikach zaobserwować można różnicę pomiędzy grupami dzieci korzystających ze wszczepu w różnych interwałach czasowych. Im dłuższy jest czas posługiwania się wszczepem, tym lepsze są osiągane wyniki w zakresie rozumienia mowy na drodze słuchowej oraz skutecznego posługiwania się językiem w kontaktach międzyludzkich. Głównym celem pooperacyjnej rehabilitacji dzieci z głuchotą prelingwalną jest rozwój mowy dźwiękowej we wszystkich jej aspektach. Wyniki podobnych badań przeprowadzonych na świecie pokazują, że rozwój mowy i języka u dzieci niesłyszących od urodzenia, zaimplantowanych wszczepem ślimakowym, jest możliwy. Dzieci z tak wielkim ubytkiem słuchu, klasycznie aparatowane, nie miałyby szans na zmysłowy dostęp do języka mówionego, który w chwili obecnej zapewnia im wszczep ślimakowy [7]. Według lingwistów każdy człowiek nosi w sobie wrodzoną, naturalną zdolność do nabywania języka [8, 9, 10]. Warunkiem ujawnienia się tych predyspozycji jest nieustanne przebywanie w środowisku, w którym zachodzi wiele procesów fonicznych i językowych. W przypadku dzieci niesłyszących od urodzeniabrak stymulacji słuchowej upośledza prawidłowy przebieg procesów recepcji i percepcji dźwięków, w tym mowy. Niemożność pełnoprawnego uczestniczenia w odkrywaniu świata dźwięków uniemożliwia spontaniczne ujawnienie się naturalnego mechanizmu nabywania kompetencji językowych. Dlatego tak ważne jest, aby umożliwić niesłyszącym dzieciom dostęp do świata dźwięków jeszcze przed trzecim rokiem życia, który przez wielu naukowców traktowany jest jako ‘złoty okres’ dla rozwoju mowy [11, 12]. Implantacja wszczepem ślimakowym w tym okresie, jak wskazują wyniki przeprowadzonych badań, daje dużą szansę na naturalny rozwój języka i mowy. Im dziecko młodsze w momencie operacji, tym ma większą szansę na samodzielne odkrywanie języka danej społeczności, tak jak jego słyszący rówieśnik [13, 14, 15]. Nie wszyscy badacze zgadzają się z tym stwierdzeniem [16], uważając, że najważniejszym czynnikiem prognostycznym jest nie wiek w chwili operacji, lecz poziom rozwoju mowy oralnej i języka przed operacją. Nie znajduje to potwierdzenia w wynikach osiągniętych przez badane dzieci w ośrodku poznańskim. Przed operacją nie posługiwały się one żadnym językiem, a używane do komunikacji formy wokalne nie mieściły się w systemie językowym. Właściwy rozwój mowy i języka nastąpił dopiero po implantacji. Czas posługiwania się implantem ślimakowym ma również duże znaczenie dla określenia wieku słuchowego każdego dziecka. Ponton i wsp. zauważyli, że im dłuższy czas użytkowania wszczepu i zarazem pooperacyjnej rehabilitacji, tym bardziej wzrasta umiejętność wykorzystania informacji słuchowych dostarczanych przez implant [17]. Obserwacje te są zbieżne z wynika-

PRACE ORYGINALNE

mi, które uzyskały przebadane dzieci. Ponad siedmioletni staż użytkowania implantu wydaje się być wystarczającym czasem na to, aby mowa foniczna i znajomość języka rozwinęła się na tyle, aby umożliwić satysfakcjonującą komunikację z innymi. Najprawdopodobniej okres kształtowania się mowy i nabywania języka u dzieci zaimplantowanych trwa tyle czasu, ile analogicznie potrzebują dzieci słyszące, aby rozumieć innych i skutecznie się komunikować. Wyniki naszych badań wskazują, że większość dzieci zaimplantowanych przed trzecim rokiem życia przejawia znajomość kodu językowego, który – choć w ich przypadku nie jest doskonały i przejawia pewne ograniczenia – umożliwia rozumienie mowy i jej nadawanie, wystarczające do nawiązywania kontaktów werbalnych. Wnioski 1. Proces rozwoju mowy i języka u dzieci zaimplantowanych podlega ciągłemu doskonaleniu. 2. Poziom rozwoju mowy oraz znajomości systemu językowego zależny jest między innymi od czasu użytkowania wszczepu ślimakowego. 3. Wszystkie dzieci implantowane osiągnęły umiejętności językowe, które – zróżnicowane w indywidualny sposób – umożliwiają nawiązanie kontaktu słownego z osobami słyszącymi. 4. Proces słuchowej percepcji mowy oraz nabywania systemu językowego trwa mniej więcej tyle czasu, ile potrzebują dzieci słyszące, aby rozwinąć język funkcjonalny. Przeciętnie taki stan osiągany jest po około siedmiu latach użytkowania wszczepu. Piśmiennictwo 1. Mueller-Malesińska M.: Program rehabilitacji chorych po wszczepieniu implantu ślimakowego. Otolaryngologia Polska, 1998, 52, 3, 367. 2. Szuchnik J.: Terapia logopedyczna osób po wszczepieniu implantów ślimakowych. W: Podstawy neurologopedii. Red. T. Gałkowski, E. Szeląg, G. Jastrzębowska, Opole 2005, 653, 661. 3. Skarżyński H.: Wszczepy ślimakowe. W: Zarys audiologii klinicznej. Red. A. Pruszewicz, Poznań 2000, 2, 517. 4. Lindner G.: Podstawy audiologii pedagogicznej. PWN, Warszawa 1976, 298. 5. Szyfter W., Pruszewicz A., Woźnica B., Szymiec E. i wsp.: Ocena zachowań słuchowych dzieci posługujących się wszczepem ślimakowym. Otolaryngologia Polska, 1997, Tom L, Suplement 22, 200-204. 6. Kurkowski Z.M.: Mowa dzieci sześcioletnich z uszkodzonym słuchem. UMCS, Lublin 1996, 60-70. 7. Geers A.E.: Speech and language evaluation in aided and implantem children. Scand Audiol., 1997, 26, 72-75. 8. Rittel T.: Podstawy lingwistyki edukacyjnej. Wydawnictwo Naukowe WSP, Kraków 1993. 9. Shugar G.: Dziecko uczestnikiem dialogu w świetle badań z psycholingwistyki rozwojowej. Nowiny Psychologiczne, 1996, 3. 10. Kurcz I.: Psychologia języka i komunikacji. WSiP, Warszawa 2000.

Rozwój mowy i języka u dzieci zaimplantowanych przed trzecim rokiem życia 11. Wygotski L.: Myślenie i mowa. WSiP, Warszawa 1989. 12. Eliot L.: Co tam się dzieje. Media Rodzina, Poznań 2003, 480-534. 13. Snik A.F.M., Makhdoum M.J.A., Vermeulen A.M. i wsp.: The relation between age at the time of cochlear implantation and long term speech perception abilities in congenitally deaf subjects. Int. J. Pediatr. Otorhin. Laryngol., 1997, 41, 121-131. 14. Lesinski A., Battmer R.D., Bertam B.: Appropriate age for cochlear implantation in children; experenience since 1986 with implanted children. Adv. Otorhinolaryngol., 1997, 52, 214-217. 15. Szagun G.: The acquisition of grammatical and lexical structures in children with cochlear implants: a developmental psycholinguistic approach. Audiol. Neurootol., 2000, 5, 39-47.

271

16. Loundon N., Busquet D., Roger G. i wsp.: Audiophonological results after cochlear implantation in 40 congenitally deaf patients: preliminary results. Intern. J. of Ped. Otorhinolaryngol., 2000; 56, 9-21. 17. Molina M., Huarte A., Cervera-Paz F.J. i wsp.: Development of speech in 2- year-old children with cochlear implant. Int. J. of Ped. Otorhinolaryngol., 1999, 47, 177-179.

Adres do korespondencji: Zakład Edukacji Katedra Nauk o Zdrowiu Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu ul. Smoluchowskiego 11 60-179 Poznań

PRACE ORYGINALNE

Nowiny Lekarskie 2011, 80, 4, 272–276

IZABELA RZYMSKA, MICHAŁ MUSIELAK

OCENA ZMIENNOŚCI WIODĄCYCH SYSTEMÓW WARTOŚCI WŚRÓD STUDENTÓW KIERUNKU POŁOŻNICTWO NA PRZESTRZENI STUDIÓW LICENCJACKICH EVALUATION OF CHANGES IN MORAL PREFERENCES AMONG MIDWIFERY STUDENTS DURING UNIVERSITY STUDIES Katedra Nauk Społecznych Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Kierownik Katedry: prof. dr hab. Michał Musielak

Streszczenie Wstęp. Studenci przychodzą na uczelnię z bagażem swoich doświadczeń i różnych wpływów moralnych. Interesujące jest to, czy można zbadać zmiany ich subiektywnej oceny owych wpływów w odniesieniu do ich kompetencji moralnych podczas edukacji na uczelni medycznej. Cel. Celem niniejszej pracy była ocena zmian kolejności osobiście uznawanych systemów wartości z próbą określenia dominujących systemów kształtujących moralność ankietowanych w powiązaniu ze wskaźnikiem kompetencji moralnej. Materiał i metoda. Zbadano 72 studentów położnictwa na Wydziale Nauk o Zdrowiu Uniwersytetu Medycznego w Poznaniu rozpoczynających I rok studiów w roku akademickim 2005/2006 roku i obserwowano ich podczas kolejnych trzech lat edukacji. Wyniki. Zaobserwowano istotny wzrost wpływu uczelni na zmiany kompetencji moralnych studentów. Również zasady bioetyczne zyskiwały na znaczeniu. Najsilniejszym czynnikiem kształtującym ich moralność są rodzice, natomiast najsłabszym Kościół. Niezmiennie wiodącym systemem etycznym dla studentów w ich przekonaniu jest ich własny system wartości. Wnioski. Uczelnia medyczna w istotny sposób wpływa na kształtowanie moralności i kompetencji moralnych studentów obok innych źródeł systemów wartości. SŁOWA KLUCZOWE: moralność, hierarchia wartości, kompetencje moralne, rozwój moralny.

Summary Introduction. Students enter the University with previous experience and moral influences. The interesting issue is whether it is possible to measure their subjective judgment changes of moral competences. Aim. The aim of the study was the evaluation of moral systems preferences and their changes with the special attention to moral scoring index. Material and method. Seventy two midwifery students were tested between 2005 and 2008 during their 3-year course. Results. We observed a statistically significant influence of medical university on moral competence. The priority of ethic rules increased. The most important factor of their moral development were parents and the less important the institution of the church. Constantly the highest priority won their own moral system. Conclusions. Medical University significantly influences the morality and moral competences among other sources of ethics. KEY WORDS: morality, morality hierarchy, moral competences, moral development.

Wstęp Życie ludzkie niesie ze sobą mnóstwo sytuacji momentalno-punktowych, które odczytujemy jako dylematy moralne. Następuje wtedy konflikt przynajmniej dwóch aksjologicznie równoważnych sił, którego nie sposób rozstrzygnąć bez naruszenia jednej z nich. W logice nazywa się to podwójnym wnioskowaniem, w którym jedna z przesłanek zawiera alternatywę [1]. Przy zróżnicowanym podejściu do moralności należy zadać pytanie, czy w ogóle można jej nauczać tak, aby nie było to ani demagogią, ani doktrynalnym moralizatorstwem? Niemożliwe jest bowiem uczynić to w sposób intersubiektywnie komunikowalny i kontrolowalny [2]. Niezależnie bowiem od przyjętej doktryny, istnieją tzw. twarde przekonania moralne, na które wszyscy się zgadzają nawet wtedy, kiedy nie można przed-

PRACE ORYGINALNE

stawić dla nich odpowiedniego opisu intelektualnego. To oczywiście nie oznacza jeszcze, że wszyscy w związku z tym mają właściwe poczucie moralności [3]. Nawet jeśli naukę o wartościach można przekazywać jak każdą inną wiedzę, nie rozwiązuje to jeszcze problemu, czy można nauczyć kogokolwiek rozwiązywania dylematów moralnych – do tego potrzebne są odpowiednie umiejętności. Czy jest w ogóle realne nauczanie etyki bez naruszania przy tym Powszechnej Deklaracji Praw Człowieka, w której znajdujemy w artykule 18, że: „Każdy człowiek ma prawo do wolności myśli, sumienia i wyznania” [4], by mogła ona być nauką uniwersalną, zarówno dla ateistów, jak i dla ludzi różnych wyznań? Innymi słowy, czy można komukolwiek narzucić zakładanie na „oczy i uszy” zmysłu moralnego takiego czy innego „filtru” jakiejkolwiek konkretnej teorii etycznej, skazując go na pewien rodzaj „daltonizmu” mo-

Ocena zmienności wiodących systemów wartości wśród studentów kierunku położnictwo na przestrzeni studiów licencjackich

ralnego? Rozwiązaniem wydaje się skupienie uwagi na kształtowaniu kompetencji moralnych. Czy w takim razie cały „biały personel” je posiada i czy jest dobrze przygotowany do korzystania z nich? Czy można im pomóc w podejmowaniu właściwych decyzji? Czy w sytuacji, kiedy tak wiele od nich zależy, medykami powinni stawać się wszyscy, czy jedynie ludzie o szczególnych predyspozycjach moralnych? Jak zbadać owe szczególne uzdolnienia i czy możliwe jest nauczanie tych osobliwych umiejętności?

273

6, 7]. Jego certyfikowaną wersję polską wykorzystano za zgodą autora. W konstrukcji dalszej części ankiety własnej posłużono się pięciostopniową skalą Likerta od -2 do +2. Skalę likerta od -2 do +2 przyporządkowano wartościom od negatywnego ekstremum (oznaczającego całkowitą dezaprobatę) do pozytywnego ekstremum (pełnej akceptacji). Komplet pomiarów, tj. ankiety z pomiarów od P1 do P4 udało się zebrać łącznie od 72 studentów. Dane zebrano w modelu zmiennych powiązanych (pomiary P1, P2, P3, P4). Zebrane dane wprowadzono do wcześniej przygotowanego arkusza kalkulacyjnego (MsExcel 2003, Microsoft Corp, USA), w którym obliczano wg wzoru index C (wskaźnik kompetencji moralnej kwestionariusz MJT). W związku z zastosowaniem skali Likerta okazało się, iż większość danych nie cechowała się normalnością rozkładu, co potwierdzono testem Kolgomorowa-Smirnova. Dlatego też analizy przeprowadzono w oparciu o testy nieparametryczne. W analizie różnic pomiędzy poszczególnymi pomiarami wielokrotnymi (P1, P2, P3, P4) zastosowano test Friedmana z analizą kontrastów testem Dunna. W pracy dokonano też podziału na studentów o początkowo wyższym niż mediana (ME) poziomie kompetencji moralnej (C-index) i niższej od mediany. Obliczenia statystyczne wykonano przy użyciu pakietu SigmaStat v3.1 (Systat, USA). Przyjęto poziom p < 0,05 jako istotny statystycznie.

Cel Celem niniejszej pracy była ocena zmian hierarchii własnych systemów wartości z próbą określenia dominujących systemów kształtujących moralność ankietowanych w powiązaniu ze wskaźnikiem kompetencji moralnej. Materiał i metoda Badaniami objęto wszystkich studentów kierunku położnictwo w trybie stacjonarnym na Wydziale Nauk o Zdrowiu Uniwersytetu Medycznego w Poznaniu, którzy rozpoczęli I rok studiów w roku akademickim 2005/2006. Badania miały charakter prospektywny. Studentów obserwowano przez 24 miesiące, tj. od ich I roku studiów (2005/2006), poprzez II rok studiów (2006/2007) do III roku studiów (2007/2008). Badanie przeprowadzono metodą ankietową, przy użyciu Kwestionariusza Rozwiązywania Dylematów Moralnych (MJT, Georg Lind) w wersji polskiej i części własnej ankiety. Kwestionariusz MJT w wersji oryginalnej oraz polskiej opisano wcześniej w literaturze [5,

Wyniki W toku studiów w punktach pomiarowych P1, P2, P3 i P4 zanotowano odpowiednio następujące zmiany wskaźni-

Tabela 1. Ocena wiodących w życiu systemów wartości Table 1. Evaluation of hierarchy of ethic systems W życiu kieruję się zasadami kościoła

rodziców

bioetycznymi

własnym systemem wartości

C-index

P1

P2

P3

P4

Test Friedmana

wszyscy

0,20 ± 1,17

0,37 ± 1,13

0,10 ± 1,24

-0,04 ± 1,19

P = 0,001*

< ME

0,29 ± 1,26

0,61 ± 1,12

0,17 ± 1,33

0,02 ± 1,24

P = 0,007*

> ME

0,12 ± 1,08

0,12 ± 1,10

0,03 ± 1,15

-0,12 ± 1,16

P = 0,16

wszyscy

0,83 ± 0,89

0,98 ± 0,73

0,92 ± 0,80

0,85 ± 0,85

P = 0,70

< ME

0,97 ± 0,64

1,14 ± 0,45

1,02 ± 0,75

0,85 ± 0,86

P = 0,36

> ME

0,69 ± 1,09

0,81 ± 0,85

0,81 ± 0,84

0,84 ± 0,87

P = 0,98

wszyscy

0,52 ± 0,84

0,59 ± 0,85

0,82 ± 0,83

0,79 ± 0,89

P = 0,026**

< ME

0,58 ± 0,65

0,58 ± 0,89

0,97 ± 0,83

0,70 ± 0,93

P = 0,019**

> ME

0,45 ± 1,17

0,59 ± 0,83

0,66 ± 0,81

0,87 ± 0,89

P = 0,22

wszyscy

1,88 ± 0,32

1,84 ± 0,36

1,82 ± 0,45

1,85 ± 0,39

P = 0,89

< ME

1,94 ± 0,23

1,88 ± 0,32

1,82 ± 0,45

1,85 ± 0,33

P = 0,50

> ME

1,81 ± 0,39

1,81 ± 0,39

1,81 ± 0,46

1,84 ± 0,36

P = 0,94

* P2 vs P4 ** P1 vs P3

PRACE ORYGINALNE

274

Izabela Rzymska, Michał Musielak

ka kompetencji moralnej (wartości średnie: 12,87; 11,50; 17,13; 11,47). Różnice w analizie wariancji okazały się statystycznie nieistotne (p = 0,14). Zadano również pytanie o to, który z systemów wartości jest istotny w życiu respondentów. Wśród ocenianych zasad wymieniono naukę Kościoła, rodziców, zasady bioetyki oraz własny system wartości. Najważniejszym systemem, którym kierują się w życiu studenci był własny system wartości, następie zasady wpajane przez rodziców, zasady bioetyki i w najmniejszym stopniu nauka Kościoła (Tabela 1). O ile legitymowanie się własnym systemem wartości respondentów oraz zasadami rodzicielskimi nie podlegało zmianom w toku studiów, to w przypadku nauki Kościoła znaczenie jego zasad spadało w czasie. Zaobserwowano

również wzrost znaczenia zasad bioetyki w życiu studentów, w każdym kolejnym pobranym pomiarze (Rycina 1). Dokonano również samooceny, która z instytucji społecznych miała w opinii studentów wpływ na ich moralność. Wyniki w czterech punktach pomiarowych oraz ich zmienność przedstawiono na rycinie 1 i w tabeli 2. Dyskusja Nacisk na sposób kształtowania u studentów moralności jest obecny zarówno w świecie, jak i na polskich uczelniach. Dzisiaj nie pojawia się już pytanie: „czy” należy w tym względzie edukować, ale „jak należy to czynić” [8]. Środowiska akademickie zdały sobie sprawę, że adepci nauk medycznych powinni być przygotowani do służenia

2 1,5 1 0,5 0 Kościół

-0,5 P1

szkoła podstawowa religia

P2

Uniwersytet Medyczny

P3

liceum

P4

rodzice

Rycina 1. Zmiany samooceny o wpływie różnych autorytetów na moralność ankietowanych Figure 1. Self-evaluation changes of moral authorities’ influences.

Tabela 2. Ocena wpływu instytucji społecznych na moralność studentów Table 2. Evaluation of social institutions influence on students’ morality P1

P2

P3

P4

Uniwersytet Medyczny

0,43 ± 0,94

0,57 ± 0,74

0,58 ± 1,06

0,85 ± 1,13

Religia Kościół

0,45 ± 1,15 -0,19 ± 1,15

0,59 ± 1,20 0,03 ± 1,23

0,42 ± 1,18 -0,12 ± 1,17

0,34 ± 1,33 -0,03 ± 1,30

Szkoła podstawowa

-0,01 ± 1,06

0,38 ± 0,89

-0,01 ± 0,89

0,30 ± 1,10

Szkoła średnia Rodzice

0,64 ± 0,94 1,82 ± 0,38

0,75 ± 0,65 1,84 ± 0,36

0,64 ± 0,91 1,79 ± 0,44

0,65 ± 1,05 1,73 ± 0,53

PRACE ORYGINALNE

Test Friedmana P < 0,001 [Test Tukey: P1:P4 p < 0,05 P = 0,27 P = 0,27 P < 0,001 [Test Tukey: P1:P2 p < 0,05 ] P = 0,93 P = 0,47

Ocena zmienności wiodących systemów wartości wśród studentów kierunku położnictwo na przestrzeni studiów licencjackich

zdrowiu nie tylko pod względem klinicznych umiejętności, ale również powinni być etycznie do tego upoważnieni. Problemem pozostaje sposób przekazu, który nie powinien być arbitralnie moralizatorski, ani odgórnie narzucać wybranego światopoglądu. Studenci, rozpoczynając studia, dysponują już bowiem bagażem moralnym, autorytetami i wykształconymi umiejętnościami (kompetencjami) moralnymi. Założenia metod nauczania wpisują się w toczącą się od wielu lat zarówno w świecie, jak i w Polsce dyskusję na temat edukowania moralności podczas studiów fachowych. W naszym kraju jest to szczególnie trudne, gdyż niezwykle mocno zakorzeniona jest tradycja związana z naukami Kościoła rzymsko-katolickiego, która jest arbitralnie zamknięta na wiele osiągnięć współczesnej medycyny. Staje się to problemem, gdyż aksjomaty wypływające z tego światopoglądu uniemożliwiają merytoryczną dyskusję. W wynikach ankiety zastosowanej w tejże pracy widoczne jest, że jeżeli student wysoko ocenia wpływ religii na swoją moralność, zazwyczaj jego kompetencje w badaniach MJT wyjściowo w pierwszym pomiarze są stosunkowo niskie, znajdują się poniżej mediany. Oznacza to, że nie jest on nauczony samodzielnego podejmowania pewnych decyzji, a jedynie odwołuje się do gotowych rozwiązań narzuconych przez katolicki katechizm. Wbrew jednak oczekiwaniom, wiara okazała się ostatnim systemem wartości, jakim kierowali się deklaratywnie studenci, choć w zderzeniu z uzyskiwaną w toku studiów wiedzą, ulegał przynajmniej fluktuacjom. Najwyżej ocenianym systemem wartości był własny system, choć ograniczeniem tego badania jest uzyskanie tej informacji jako samooceny. Ankietowani również przyjmowali (i oceniali wysoko) rodziców jako źródło ich systemu wartości oraz zasady bioetyki wpajane w toku studiów (uznanie dla nich nota bene rosło). Osobnym zagadnieniem jest sama moralność jako zbiór wzorców użytkowanych przez studentów. I tu ponownie autorytet rodziców w opinii ankietowanych najbardziej na nią wpływał, religia czy instytucja Kościoła – znacznie mniej. W kształtowaniu moralności znaczącą rolę odegrały też w opinii studentów szkoły, głównie średnia i Uniwersytet. Ale co ciekawe, sami psychologowie o konotacjach chrześcijańskich uznając za najwyższe docelowe stadium rozwoju autonomii uważają, że nie powinno ono w ogóle występować u chrześcijan [9]. W tej sytuacji nie może być mowy o niezawisłej moralności. Trafniejszym określeniem dojrzałości moralnej chrześcijan jest termin teonomia użyty między innymi przez Jana Pawła II w Encyklice „Veritatis splendor”. Sytuacja chrześcijan i innych osób funkcjonujących w ramach różnego typu organizacji, takich jak właśnie Kościół, wojsko, czy chociażby uczelnia, niewątpliwie nie pomaga w rozwijaniu kompetencji moralnych [10] . Oczywiście zmiany podejścia do zagadnień moralnych u młodych ludzi są całkiem naturalne. L. Kohlberg, wbrew temu co twierdził Piaget, uważał, że stadium postkonwencjonalne osiągalne jest dopiero w wieku młodzieńczym, a nie dziecięcym. Potwierdzają to badania amerykańskiego pedagoga Williama Perry’ego. Przeprowadził on interesujące pomiary, których wyniki interpretuje się w następujący

275

sposób: podczas studiów moralność Amerykanów obniża się, ponieważ przechodzą od znanych sobie dotychczas prostych, „czarno-białych” sposobów wartościowania świata, poprzez fazę zwątpienia w wartości absolutne, do punktu, w którym odczuwają potrzebę samodzielnego zaangażowania się w utworzenie osobistego systemu wartości i jego odpowiedzialną realizację [5, 11]. Potwierdza to założenie psychologii rozwojowej L. Kohlberga, iż punktem docelowym kształtowania się moralności jest osiągnięcie w niej autonomii – to powoduje w takim razie pewien dyskomfort dla ludzi głęboko wierzących, szczególnie katolików, gdyż jak wcześniej wspomniano, tam indywidualne, samodzielne rozstrzygnięcia nie są wskazane. Po drugie, dokładnie odzwierciedlają uśrednione zmiany wartości C-indeksu podczas przebiegu studiów polskich studentów położnictwa. W niniejszych badaniach widoczne jest to podczas drugiego pomiaru P2 – odpowiada to fazie zwątpienia w badaniach Perry’ego. Faza ta pozwala na nowo budować swój system wartości, który docelowo powinien stać się autonomiczny. Niestety pod wpływem różnych czynników zakłócających nie dla wszystkich ten cel staje się osiągalny, co widoczne jest w nie najwyższych wartościach C-indeksu w czwartym pomiarze kompetencji (P4). Nieznacznie lepiej wyglądało to we wcześniejszych badaniach przekrojowych, przeprowadzonych na podobnym wycinku społeczności Uniwersytetu Medycznego w Poznaniu [12]. Najczęściej oceniana w literaturze przedmiotu jest korelacja pomiędzy religijnością a wskaźnikiem kompetencji (C-indeks). Wyniki są zaskakująco zgodne w większości analiz. W niniejszej pracy, podobnie jak i we wcześniejszych przekrojowych badaniach pilotażowych autorki, okazało się, że osoby o wyższym wskaźniku kompetencji znacznie mniej ceniły sobie obecność wiary w swoim życiu. W University of Chicago oraz Yale New Haven Hospital przeprowadzono badania, podczas których zankietowano 1144 praktykujących lekarzy wszystkich specjalności [13]. Farr Curlin z University of Chicago, współtwórca wspomnianych badań, wyraził swoje zaskoczenie, gdyż okazało się, że niezależnie od deklarowanego wyznania, pomimo iż wszystkie religie: judaizm, buddyzm, islam, hinduizm, czy chrześcijaństwo nawołują do niesienia pomocy potrzebującym, tylko 31 procent spośród mieniących siebie wierzącymi lekarzy leczyło bezinteresownie. Filantropijnych medyków wśród uznających siebie za ateistów lub agnostyków było więcej, bo 35 procent. I rzeczywiście, również pomiary przeprowadzone za pomocą MJT w wielu badaniach na różnych kierunkach studiów (prawo, medycyna, ekonomia) potwierdzały tą odwrotną zależność – im wyższa deklarowana religijność, tym niższy osiągany wskaźnik kompetencji. Choć trzeba wspomnieć o pewnej ambiwalencji odpowiedzi respondentów w ogólnej strukturze odpowiedzi na pytania o elementy religijności – tylko 32% określa siebie jako osoby religijne, choć 94% twierdzi, iż wierzy w Boga [14]. Brak zależności wprost pomiędzy kompetencjami moralnymi a indywidualną oceną własnej wiary, choć

PRACE ORYGINALNE

276

Izabela Rzymska, Michał Musielak

jest zgodny z współczesnymi badaniami, nie ma uzasadnienia w klasycznych teoriach etycznych. Nie przystaje na przykład w swych założeniach systemowych do etyki Immanuela Kanta. Filozof ten, odwrotnie niż to wynika z tej paraleli, dowodził o wyższości czynów dokonanych z poczucia obowiązku, a więc niejako dokonanych na bazie obowiązujących kodeksów moralnych [15]. Obecne badania sugerują, że osoby wiernie (doktrynalnie) funkcjonujące w określonym kodeksie moralnym, na przykład religijnym, bardzo często hamują swój indywidualny rozwój moralny, wyłączając osobistą odpowiedzialność za swoje czyny. Łatwiej jest im odwołać się do obowiązującej normy niż samodzielnie rozstrzygnąć stojący przed nim dylemat moralny. Coraz częściej zauważa się, że to powoduje eliminację tzw. wentyla bezpieczeństwa etycznego. A kogoś postępującego w ten sposób trudno uznać za kompetentnego moralnie. Należy pamiętać, że na osobach pełniących takie role społeczne jak właśnie lekarze, pielęgniarki czy położne spoczywają szczególne obowiązki i oczekiwania związane z ich funkcjami zawodowymi, które są rolami nabytymi [16].

6. 7. 8. 9.

10.

11.

Wnioski 1. Wiodącym systemem wartości w opinii studentów był ich własny system wartości. 2. Zaobserwowano, że podczas studiów waga zasad bioetyki w hierarchii systemów wartości istotnie wzrasta. 3. Największy wpływ na kształtowanie moralności studentów w ich opinii mieli rodzice, a najmniejszy Kościół. 4. Zaobserwowano, że w opinii studentów wpływ edukacji na Uniwersytecie Medycznym na kształtowanie ich moralności istotnie wzrasta.

12.

13.

14.

Piśmiennictwo 1. Krajewski W. (red.): Słownik pojęć filozoficznych. Scholar, Warszawa 1996, 37. 2. Ajdukiewicz K.: Podstawowe zagadnienia i kierunki filozofii. Antyk, Kęty 2003, 34-46. 3. Mothersill M.: The Moral Dilemmas Debate. w: Mason H.E.: Moral Dilemmas and Theory, New York 1996, Oxford University Press, 66-85. 4. Biesaga T.: Gwarancje i zagrożenia klauzuli sumienia. Med. Prakt., 2008, 12. 5. Hock R.R.: 40 prac badawczych, które zmieniły oblicze psychologii. Czy jesteś człowiekiem moralnym? Kohlberg L. (1963): Powstawanie orientacji na porządek moralny u dzieci: Sekwencyjność rozwoju rozumowania moral-

PRACE ORYGINALNE

15. 16.

nego. Gdańskie Wydawnictwo Psychologiczne, wyd. 1, Gdańsk 2003, 244-253. Lind G.: http://www.uni-konstanz.de/ag-moral/, dostępność listopad 2009. Lind G.: http://www.uni-konstanz.de/ag-moral/moral/dildisk-d.htm, dostepność listopad 2009. Hartman J.: Prolegomena do teorii kompetencji. Nowa Krytyka, Czasopismo Filozoficzne, http://www.nowakrytyka.pl/spip.php?article167, dostępność 23 czerwca 2005. Gołąb A.: O rozwoju moralnym chrześcijan, Konferencja Chrześcijańskiego Forum Pracowników Nauki, Nauka – Etyka – Wiara 2005, materiały pokonferencyjne Ruch Nowego Życia, Warszawa 2005. Encyklika Veritatis Splendor (Blask prawdy) Jan Paweł II: Do wszystkich biskupów Kościoła katolickiego o niektórych podstawowych problemach nauczania moralnego Kościoła, Rzym 1993-08-06, http://www.opoka.org.pl/ biblioteka/W/WP/jan_pawel_ii/encykliki/veritatis_1.html, podtytuł: Podstawowe problemy nauczania moralnego Kościoła – 6 sierpnia 1993. Perry W.: Forms of intellectual and ethical development in the college years. Holt, Rinehart and Winston, New York, 1968, za: Andrzej Gołąb „O rozwoju moralnym chrześcijan”, Konferencja Chrześcijańskiego Forum Pracowników Nauki, Nauka – Etyka – Wiara 2005, materiały pokonferencyjne Ruch Nowego Życia, Warszawa 2005. Rzymska I., Musielak M.: Ocena postaw moralnych wobec ludzkiego rozrodu wśród studentów kierunku położnictwo Akademii Medycznej w Poznaniu: Przegl. Ginekol.-Położ., 2006, 6(3), 149-155. Rotkiewicz M.: Gramatyka moralności: w: „Polityka”, http://www.polityka.pl/zobacztakze/Lead01,936,230830,18/, dostępność z dnia 23.06.2009. Glanzer D., Nipe G., Lind G.: Does Cross-Cultural Experience Foster Moral Judgment Competence in College Students? Poster presentation at the Meeting of the Association for Moral education (AME) in New York, November, 2007. Kant I.: Uzasadnienie metafizyki moralności (tłum. M. Wartenberg) 11-38, 49-402. Ossowska M.: Socjologia moralności. Zarys zagadnień. Warszawa 2005, Wydawnictwo Naukowe PWN, 65-67.

Adres do korespondencji: dr n. med. Izabela Rzymska Katedra Nauk Społecznych Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu ul. Dąbrowskiego 79 Poznań

Nowiny Lekarskie 2011, 80, 4, 277–282

KRYSTYNA KUROWSKA, ANNA ZUZA-WITKOWSKA

EMPATIA A WYPALENIE ZAWODOWE U PIELĘGNIAREK ONKOLOGICZNYCH EMPATHY AND OCCUPATIONAL BURNOUT OF ONCOLOGICAL NURSES Katedra i Zakład Pedagogiki i Dydaktyki Pielęgniarskiej CM w Bydgoszczy UMK Toruń Kierownik: dr n. med. Mirosława Felsmann

Streszczenie Wstęp. Okazywanie współczucia, zrozumienia, ciągłe bycie z pacjentem, niejednokrotnie cierpiącym, pozbawionym nadziei, często prowadzi do zjawiska nazywanego wypaleniem zawodowym. Celem pracy było określenie wpływu poziomu empatii na stopień wypalenia zawodowego u pielęgniarek onkologicznych. Materiał i metody. Badaniem została objęta grupa 109 pielęgniarek pracujących w Centrum Onkologii w Bydgoszczy. Poziom empatii zbadano za pomocą Indeksu Reaktywności Interpersonalnej H.M. Davisa, a stopień wypalenia zawodowego w oparciu o kwestionariusz MBI Ch. Maslach. Wyniki. Pielęgniarki onkologiczne nieznacznie różnią się poziomem empatii oraz stopniem wypalenia zawodowego. Empatia na wypalenie zawodowe wpływa we wszystkich jego komponentach, zarówno na wyczerpanie emocjonalne, depersonalizację, jak i na poczucie braku osobistych dokonań. Wnioski. Prowadzenie dalszych badań w tej kwestii pozwoli na lepsze zrozumienie zjawiska empatii oraz zespołu wypalenia zawodowego, co powinno doprowadzić do udoskonalenia metod rozwoju empatii, a także sposobów zapobiegania wypaleniu zawodowemu wśród pielęgniarek onkologicznych, jak również osób niosących pomoc innym ludziom. SŁOWA KLUCZOWE: empatia, wypalenie zawodowe, pielęgniarki onkologiczne.

Summary Introduction. Demonstrating compassion and understanding, always being with patients who often are in pain and are lacking hope, may lead a nurse to a phenomenon called occupational burnout. The aim of this study is to determine the effect of empathy on the degree of burnout among oncology nurses. Material and method. The study included 109 nurses working in the Oncology Centre in Bydgoszcz. The level of empathy was examined with the Interpersonal Reactivity Index (H.M. Davis) and the degree of burnout using the MBI questionnaire based on Ch. Maslach. Results. The level of empathy and the degree of burnout fluctuates marginally among the oncology nurses. Empathy can be a cause of occupational burnout in all its forms, like emotional exhaustion, depersonalization and the loss of meaning of personal achievement. Conclusions. Further research on this issue may be required in order to allow better understanding of the relation between empathy and the burnout syndrome. This would lead to the improved training methods in the development of empathy and to better ways of detecting and preventing burnout among oncology nurses and aid workers. KEY WORDS: empathy, burnout, oncology nurses.

Wstęp Pielęgniarstwo jest zawodem, w którym oprócz wysokich kwalifikacji i uzyskanych kompetencji ważne są pewne cechy charakteru i postaw pielęgniarki. Wykonywanie wszystkich czynności związanych z opieką i pielęgnacją osób chorych, w szczególności pacjentów z chorobą nowotworową, wymaga od pielęgniarki życzliwości, współczucia, dodawania otuchy i nadziei, lecz przede wszystkim doświadczania ich emocji i okazywania empatii. Zjawisko empatii interesuje przedstawicieli rożnych nauk, głównie psychologów, i rozpatrywane jest w związku z rozwojem etycznym, emocjonalnym i społecznym człowieka. Okazywanie współczucia, zrozumienia, ciągłe bycie z pacjentem, niejednokrotnie cierpiącym, pozbawionym nadziei, często prowadzi do zjawiska nazywanego wypaleniem zawodowym. Syndrom wypalenia zawodowego kojarzy się z „…gasnącym płomieniem, zgliszczami, popiołem (…). Dotyczy ludzi, którzy ulegli wypaleniu zawodowemu, tak

zwanej chorobie „z nadmiernego zaangażowania się” [1] i ma wymiar wieloaspektowy. Materiał i metoda badawcza Zaprezentowane badania stanowią wycinek realizacji szerszego projektu analizy jakości życia pracowników ochrony zdrowia. Badania przeprowadzono w okresie od lipca do grudnia 2011 roku w grupie 109 pielęgniarek pracujących na oddziałach zabiegowych, zachowawczych oraz w przychodni Centrum Onkologii w Bydgoszczy, za zgodą komisji bioetycznej Collegium Medicum im. L. Rydygiera w Bydgoszczy (KB/535/2011). W przeprowadzonych badaniach wykorzystano Indeks Reaktywności Interpersonalnej Davisa, skalę MBI Ch. Maslach (polska wersja według adaptacji Pasikowskiego) oraz ankietę konstrukcji własnej, odnoszacą się do różnych aspektów życia. Interpersonalny Indeks Reaktywności M. H. Davisa (IRI) składa się z 28 twierdzeń

PRACE ORYGINALNE

278

Krystyna Kurowska, Anna Zuza-Witkowska

tworzących 4 podskale (7 pozycji w skali), przy każdym pytaniu podano 5 możliwych odpowiedzi: • Skala 1 (PT – Perspective Taking/TT – Przyjmowania Perspektywy) – dotyczy umiejętności przyjmowania perspektywy innych osób czyli spontanicznego przyjmowania cudzego punktu widzenia. • Skala 2 (F – Fantasy/F – Fantazji) – mierzy zdolność rozumienia uczuć postaci fikcyjnych poprzez wyobrażanie sobie siebie w uczuciach i zachowaniach tychże postaci. • Skala 3 (EC – Emphatic Concern/ET – Empatycznej Troski) – ocenia poziom tendencji do empatyzowania czyli doświadczenia uczuć ciepła, sympatii i współczucia w kontaktach z innymi ludźmi oraz stosunek osoby badanej do nieszczęścia innych. • Skala 4 (PD – Personal Distress/OP – Osobistej Przykrości) – ocenia typowe reakcje emocjonalne, w tym lękowe, związane z dyskomfortem w konfrontacji z negatywnymi emocjami odczuwanymi przez innych. Sumuje się oddzielnie punkty uzyskane w odpowiedzi w każdej podskali. Wyższe wyniki w każdej dziedzinie odpowiadają wyższemu poziomowi empatii. IRI opiera się na samoocenie badanego w odniesieniu do niektórych cech osobowości, zachowań i postaw [2]. Skala MBI (Maslach Burnout Inventory) Christiny Maslach składa się z 22 pozycji (podzielonych na trzy nierówne grupy), pozwalających oszacować trzy elementy zespołu wypalenia: wyczerpanie emocjonalne, depersonalizację oraz obniżone poczucie osobistych dokonań. Wyniki oblicza się oddzielnie dla każdej z podskal. W skali od 0 do 6 pozwala to ocenić stopień wypalenia w trzech wymiarach. Podskale obliczane są oddzielnie poprzez sumowanie wyników uzyskanych dla poszczególnych wymiarów [3]. Ankieta konstrukcji własnej zawiera 21 pytań zamkniętych, dotyczących danych osobowych, sytuacji materialnej, społecznej, pracy zawodowej a także objawów niepożądanych związanych z wypaleniem zawodowym. Do opisu zmiennych wykorzystano statystyki opisowe (średnia arytmetyczna minimum, maksimum, odchylenie standardowe) oraz rozkłady zmiennych. Badanie związków przeprowadzono za pomocą współczynnika korelacji Spearmana, a testem U Manna-Whitneya dokonano oceny różnic pomiędzy dwoma grupami. Za istotne statystycznie przyjęto wartości testu spełniające warunek, że p < 0,05. Analizy wykonano przy pomocy pakietu statystycznego STATISTIKA 9.0. Wyniki badań Liczniejszą grupę stanowiły badane w wieku powyżej 40 lat (50,5%), zamężne (89%), mieszkające w mieście (82,6%), z wykształceniem wyższym magisterskim (45%), ze specjalizacją (19,3%). Średnia stażu pracy w zawodzie badanych pielęgniarek wyniosła niespełna 19 lat (18,8), a w ośrodku onkologicznym 11 lat (10,91). Zdecydowana większość była zdania, że atmosfera w pracy wpływa na wykonywanie zadań zawodowych (95,4%), relacje między współpracownikami wpływają na samopoczucie (96,3%),

PRACE ORYGINALNE

praca zawodowa na życie osobiste (73,4%), pozytywne emocje wywołuje praca z pacjentem (93,6%), odczuwają satysfakcję z wykonywanego zawodu (83,5%), radzą sobie z powierzonymi obowiązkami pielęgniarki (57,8%), nie są zadowolone i nie odczuwają satysfakcji z otrzymywanego wynagrodzenia (61,5%). Badane pielęgniarki stwierdziły, że wiedzą na czym polega zespół wypalenia zawodowego. Najczęściej zaznaczanym objawem był brak cierpliwości, drażliwość (43,6%) i odczuwane zmęczenie fizyczne (30,3%). Analizie poddano poziom empatii określony narzędziem skonstruowanym przez M.H. Davisa (Indeks Reaktywności Interpersonalnej), pozwalającym ocenić cztery komponenty empatii (Tabela 1). W komponencie empatii, jakim jest przyjmowanie perspektyw czyli przyjmowanie cudzego punktu widzenia, najwyższy wynik uzyskały pielęgniarki z przychodni (17,83), najniższy z oddziału zabiegowego (17,49). Średnie bardzo zbliżone oscylują wokół średniej całej badanej grupy. Fantazja mierzy zdolność rozumienia uczuć postaci fikcyjnych poprzez wyobrażanie sobie siebie w uczuciach i zachowaniach tychże postaci. Najwyższy wynik w tym komponencie empatii uzyskały badane pielęgniarki z przychodni (13,5), najniższy z oddziału zachowawczego (13,3). Średnie są bardzo zbliżone i oscylują wokół średniej całej badanej grupy. Wynik najwyższy dotyczący empatycznej troski (inaczej tendencji do doświadczania uczuć ciepła, sympatii i współczucia w kontaktach z innymi ludźmi oraz stosunku do nieszczęścia innych) uzyskały badane pielęgniarki z przychodni (18,5), najniższy z oddziału zachowawczego (17,7). Średnie – bardzo zbliżone, oscylujące wokół średniej całej badanej grupy. Najwyższy wynik w komponencie empatii, jakim jest osobista przykrość, uzyskały badane pielęgniarki z przychodni (13,83), najniższy z oddziału zachowawczego (13,35). W tym komponencie również średnie są bardzo zbliżone, oscylują wokół średniej całej badanej grupy. Podsumowując, ze wszystkich podskal empatii najwyższy wynik uzyskały pielęgniarki w podskali empatyczna troska (18,1), najniższy w podskali fantazja (13,39). Podobnie kształtowały się wyniki w analizowanych oddziałach. Wyjątek stanowią badane z oddziału zachowawczego, gdzie najwyższe wyniki uzyskały w podskali przyjmowanie perspektyw. Poziom wypalenia zawodowego analizowano zbierając dane ze skali MBI (Maslach Burnout Inventory) Christiny Maslach (Tabela 2), sprawdzono jej trzy wymiary. Badane pielęgniarki jako całość grupy osiągnęły wysoki wynik poczucia braku osobistych osiągnięć (30,44), na pograniczu z wynikami umiarkowanymi. Zasadniczo w analizowanych grupach wyniki braku osobistych osiągnięć nie różnią się. Najwyższe poczucie braku osobistych osiągnięć prezentują badane pielęgniarki z oddziałów zachowawczych (28,88), najniższy z przychodni (31,47). Z oddziału zabiegowego wyniki niskie uzyskało 15,4%, z zachowawczego 10% i z przychodni 20%. Badane pielęgniarki jako całość grupy osiągnęły umiarkowany wynik poczucia wyczerpania emocjonalnego (19,39). W poszczególnych analizowa-

Empatia a wypalenie zawodowe u pielęgniarek onkologicznych

279

wawczego, 43,3% z przychodni. Badane pielęgniarki jako całość grupy osiągnęły wysoki wynik poczucia braku osobistych osiągnięć (30,44), na pograniczu z wynikami umiarkowanymi. Wyniki braku osobistych osiągnięć nie różnią się. Najwyższe poczucie braku osobistych osiągnięć prezentują badane pielęgniarki z oddziałów zachowawczych (28,88), najniższy z przychodni (31,47). Respondentki jako całość grupy osiągnęły umiarkowany wynik poczucia wyczerpania emocjonalnego (19,39). W poszczególnych analizowanych grupach wyniki wyczerpania emocjonalnego różnią się. Najbardziej wyczerpane emocjonalnie są pielęgniarki z przychodni (21,27), najmniej z oddziału zachowawczego (16,85), co jest w ogóle wynikiem nis-

nych grupach wyniki wyczerpania emocjonalnego różnią się. Najbardziej wyczerpane emocjonalnie są pielęgniarki z przychodni (21,27), najmniej z oddziału zachowawczego (16,85), co jest w ogóle wynikiem niskim. Z oddziału zabiegowego wyniki niskie uzyskało 38,5%, z zachowawczego 60% i z przychodni 40%. Badane pielęgniarki jako całość grupy osiągnęły niski wynik depersonalizacji (6,25). W poszczególnych analizowanych grupach wyniki depersonalizacji różnią się nieznacznie. Najniższy wynik depersonalizacji osiągnęły pielęgniarki z oddziału zachowawczego (5,18), najwyższy z przychodni (7,2), co jest wynikiem umiarkowanym. Wyniki niskie osiągnęło 56,4% pielęgniarek z oddziału zabiegowego, 62,5% z oddziału zachoTabela 1. Wyniki empatii – zestawienie zbiorcze Table 1. Results of empathy – a summary empatia

przyjmowanie perspektyw SD x

fantazja

empatyczna troska

osobista przykrość

x

SD

x

SD

x

SD

zabiegowy

17,49

3,663

13,38

4,482

18,21

4,275

13,74

4,115

zachowawczy

17,78

2,475

13,30

4,109

17,70

4,052

13,35

3,585

przychodnia

17,83

3,630

13,50

4,431

18,50

3,540

13,83

3,715

razem

17,69

3,240

13,39

4,295

18,10

3,979

13,62

3,788

oddział

Tabela 2. Wypalenie zawodowe – zestawienie zbiorcze Table 2. Burnout – a summary wypalenie zawodowe oddział

poczucie braku osobistych osiągnięć SD x

wyczerpanie emocjonalne SD x

depersonalizacja

x

SD

zabiegowy

31,26

7,624

20,54

10,169

6,62

5,547

zachowawczy

28,88

6,977

16,85

8,943

5,18

3,782

przychodnia

31,47

7,956

21,27

10,970

7,20

4,715

razem

30,44

7,521

19,39

10,071

6,25

4,763

Tabela 3. Korelacje wyników wypalenia zawodowego i empatii Table 3. Correlation of burnout and empathy results podskala poczucie braku osobistych osiągnięć & przyjmowanie perspektywy poczucie braku osobistych osiągnięć & fantazja

N

R

t(N-2)

poziom p

109

-0,314

-3,427

0,001

109

-0,173

-1,821

0,071

poczucie braku osobistych osiągnięć & empatyczna troska

109

-0,085

-0,886

0,377

poczucie braku osobistych osiągnięć & osobista przykrość

109

0,133

1,389

0,168

wyczerpanie emocjonalne & przyjmowanie perspektywy

109

-0,020

-0,205

0,838

wyczerpanie emocjonalne & fantazja

109

-0,030

-0,306

0,760

wyczerpanie emocjonalne & empatyczna troska

109

0,075

0,778

0,438

wyczerpanie emocjonalne & osobista przykrość

109

0,233

2,477

0,015

depersonalizacja & przyjmowanie perspektywy

109

-0,091

-0,942

0,348

depersonalizacja & fantazja

109

0,049

0,510

0,611

depersonalizacja & empatyczna troska

109

0,058

0,600

0,550

depersonalizacja & osobista przykrość

109

0,228

2,424

0,017

PRACE ORYGINALNE

280

Krystyna Kurowska, Anna Zuza-Witkowska

kim. Podsumowując, wypalenie zawodowe to niskie wyniki dokonań osobistych (poczucie braku osobistych osiągnięć), przy wysokich wynikach wyczerpania emocjonalnego i wysokich wynikach depersonalizacji. Takich kobiet odnotowano łącznie 4,6%. Typowy objaw wypalenia zawodowego prezentowały pielęgniarki (6,7%) pracujące w przychodni – wysokie wyniki wyczerpania emocjonalnego, depersonalizacji i niskie w skali dokonań osobistych. Z kolei pielęgniarki (2,6%) z oddziału zabiegowego i z zachowawczego (2,5%) – wysokie wyniki wyczerpania emocjonalnego, umiarkowane depersonalizacji i niskie dokonań osobistych. Wreszcie inne pielęgniarki z oddziału zabiegowego – umiarkowane wyniki wyczerpania emocjonalnego i depersonalizacji, niskie dokonań osobistych. Wymienione kobiety to właściwie przypadki skrajnego wyczerpania emocjonalnego. Zatem wśród osób, o których można powiedzieć, że są wypalone zawodowo znalazły się pielęgniarki z oddziału zabiegowego (5,6%), pielęgniarki z oddziału zachowawczego (2,5%) oraz pielęgniarki z przychodni (6,7%). Wraz ze wzrostem wyników w skali osobistych dokonań i ewentualnym spadkiem wyczerpania emocjonalnego i depersonalizacji spada poziom wypalenia zawodowego. Przykładem kobiet, w przypadku których nie można mówić o wypaleniu zawodowym jest 17,4% badanych, które uzyskały niskie wyniki wyczerpania emocjonalnego i depersonalizacji a wysokie w skali dokonań osobistych. W oddziale zabiegowym było ich 12,8%, w zachowawczym 25% (co czwarta badana pielęgniarka) a w przychodni 13,3%. Kolejnych 33% osób uzyskało umiarkowane wyniki wyczerpania emocjonalnego, niskie depersonalizacji i wysokie dokonań osobistych: 10,3% z oddziału zabiegowego, 10% z oddziału zachowawczego i 10% z poradni. Kolejne osoby (5,5%) uzyskały niskie wyniki wyczerpania emocjonalnego, umiarkowane depersonalizacji i wysokie dokonań osobistych: było ich 2,5% na oddziale zabiegowym, 10% na oddziale zachowawczym i 3,3% w przychodni. Zatem wśród osób, o których można powiedzieć, że mają niski poziom wypalenia zawodowego znalazło się 25,6% pielęgniarek z oddziału zabiegowego, 45% z oddziału zachowawczego oraz 26,7% badanych z przychodni. W następnym kroku analizie poddano związek pomiędzy wypaleniem zawodowym a empatią (Tabela 3). Ze względu na poziom istotności (p < 0,05) odnotowano trzy ważne statystycznie współzależne dotyczące wypalenia zawodowego a empatii u pielęgniarek: na poziomie średnim poczucie braku osobistych osiągnięć i przyjmowanie perspektywy (r = -0,31; p < 0,0001); w korelacji niskiej wyczerpanie emocjonalne i osobista przykrość (r = 0,23; p < 0,0015) oraz depersonalizacja i osobista przykrość (r = -0,22; p < 0,0017). Wraz ze wzrostem wyników poczucia braku osobistych osiągnięć malały wyniki przyjmowania perspektywy. Najwyższe wyniki osobistej przykrości osiągały pielęgniarki o umiarkowanych wynikach wyczerpania emocjonalnego, najniższe natomiast o niskich wynikach wyczerpania emocjonalnego. Wraz ze wzrostem wyników depersonalizacji wzrastały wyniki osobistej przykrości.

PRACE ORYGINALNE

Dyskusja Opieka pielęgniarska nad ciężko i często nieuleczalnie chorym wymaga wielu sił i kwalifikacji zawodowych, a także cierpliwości, otwartości i wrażliwość na potrzeby i cierpienia innych. Pielęgniarki to jedna z grup zawodowych najbardziej narażonych na zespół wypalenia zawodowego, określany jako ensemble objawów psychicznych i somatycznych związanych z wykonywanym zawodem [4]. Może mieć to związek z tym, że pielęgniarki, wykonując swoje zadania pielęgnacyjne, często kierują się empatią, współczuciem i troską o pacjenta. Przeprowadzone badania pozwoliły na osiągnięcie głównego celu, jakim było określenie poziomu empatii oraz stopnia wypalenia zawodowego u pielęgniarek onkologicznych, a także określenie zależności pomiędzy empatią a wypaleniem zawodowym. Badania zostały przeprowadzone na grupie 109 pielęgniarek zatrudnionych na oddziałach zachowawczych i zabiegowych oraz w przychodni Centrum Onkologii w Bydgoszczy. W pierwszej części skupiono się na określeniu poziomu empatii u pielęgniarek onkologicznych. Badania wskazały, iż przeciętny badany to kobieta w wieku około 40 lat (zakres wieku 22–56 lat), ze stażem pracy w ośrodku onkologicznym około 11 lat, mieszkająca w mieście, zamężna, z wykształceniem wyższym magisterskim lub licencjackim. W odpowiedzi na pytanie, jaki poziom empatii wykazują pielęgniarki onkologiczne, można stwierdzić, iż ogólne średnie wyniki wszystkich badanych grup są bardzo zbliżone i utrzymują się na wysokim poziomie. W zależności od specyfiki oddziału w jakim pracują, wyniki poszczególnych komponentów empatii, poddanych analizie, są nieznacznie zróżnicowane. Ze wszystkich podskal empatii najwyższy wynik uzyskały pielęgniarki w części dotyczącej empatycznej troski, czyli doświadczania uczucia ciepła, sympatii i współczucia w stosunku do innych ludzi. Wynik ten dotyczył szczególnie pielęgniarek pracujących w przychodni (18,5). Najniższy wynik osiągnięto w podskali fantazja (13,39), który odnosił się zarówno do oddziałów zabiegowych, jak i przychodni, natomiast pielęgniarki z oddziałów zachowawczych najwyższe wyniki uzyskały w przyjmowaniu perspektyw jako spontanicznym wczuwaniu się w sytuacje innych. Badane powyżej 40 r.ż. oraz mieszkające w mieście uzyskały wyższe wyniki we wszystkich podskalach empatii. Wyjątek stanowi osobista przykrość, gdzie wyższe wyniki zdobyły mieszkanki wsi. Wilczek-Rużyczka [5] badając poziom empatii pielęgniarek i lekarzy pracujących w ośrodkach o różnej specyfice, uzyskała odmienne rezultaty, z których dowiadujemy się, że wyższy średni wynik uzyskały pielęgniarki podstawowej opieki zdrowotnej, najniższy pielęgniarki niezabiegowe, natomiast u lekarzy rezultat był odwrotny. W drugim etapie sprawdzono poziom wypalenia zawodowego pielęgniarek pracujących na poszczególnych oddziałach. Badając poszczególne ingredienty wypalenia zawodowego uzyskano obraz pielęgniarek, które osiągnęły wysoki wynik poczucia braku osobistych osiągnięć (30,44). Najwyższe

Empatia a wypalenie zawodowe u pielęgniarek onkologicznych

poczucie braku osobistych osiągnięć prezentują badane pielęgniarki z oddziałów zachowawczych, najniższe z przychodni. Pielęgniarki jako całość grupy osiągnęły umiarkowany wynik poczucia wyczerpania emocjonalnego. Jednakże w analizowanych grupach wyniki tego komponentu różnią się. Najbardziej wyczerpane emocjonalnie są pielęgniarki z przychodni (21,27), które czują się zmęczone, gdy wstają rano i muszą stanąć do kolejnego dnia intensywnej pracy a pod koniec dnia czują się wyczerpane; najmniej – pracujące w oddziałach zachowawczych (wynik niski – 16,85). We wszystkich badanych grupach pielęgniarki wykazują niskie wyniki depersonalizacji. Większość respondentek, odpowiadając na zadawane pytania, najwyższą ilość punktów otrzymała przy kwestii „obawiam się, że moja praca coraz bardziej zmienia mnie emocjonalnie”. Porównano uzyskane w badaniach wyniki wymiarów wypalenia zawodowego z opisami zawartymi w literaturze oraz badaniami przeprowadzonymi przez Pytkę i wsp. [6] wśród pielęgniarek pracujących w wybranych hospicjach stacjonarnych województwa mazowieckiego. Autorzy podają, iż u zdecydowanej większości respondentek nie zauważono objawów depersonalizacji, u części badanych zaobserwowano dystansowanie się wobec trudnych sytuacji zawodowych. Niektóre pielęgniarki mają obniżone poczucie dokonań zawodowych. Orzechowska i wsp. [4] wykazała średni stopień wyczerpania emocjonalnego wśród lekarzy, natomiast u 49% badanych pielęgniarek wysoki poziom wyczerpania emocjonalnego. Natomiast Wilczek-Rużyczka [5] wykazała wysokie wyniki w utracie osobistych osiągnięć u pielęgniarek niezabiegowych, a w pozostałych elementach wypalenia zawodowego, u ponad połowy badanych pielęgniarek uzyskała niski poziom. Podobne wyniki uzyskały Dębska i Cepuch [1], które twierdzą, że niskie średnie wyników w skali depersonalizacji przemawiają za prawidłową relacją pielęgniarka-pacjent. Można stwierdzić, że różnice w natężeniu wypalenia zawodowego pielęgniarek onkologicznych wynikają ze specyfiki pracy jaką wykonują, ale także zależne są od takich składowych, jak wiek, staż pracy w zawodzie oraz ośrodku onkologicznym. Duży wpływ ma również satysfakcja z otrzymywanego wynagrodzenia (p < 0,05). 100% badanych pielęgniarek wie na czym polega zespół wypalenia zawodowego, potrafi określić objawy związane z syndromem, większość respondentek jako najczęstszy objaw zgłasza brak cierpliwości, drażliwość oraz brak chęci do pracy. Lewandowska i Litwin [7] potwierdzają istnienie zmiennych wpływających na rozwój zespołu wypalenia zawodowego. Autorki zaliczają do nich specyfikę pracy, obciążenie psychiczne, brak właściwych warunków do leczenia, niskie zarobki, a także niski status zawodowy. Do podobnych wyników doszliśmy we wcześniejszych badaniach określających wpływ poziomu poczucia koherencji na stopień wypalenia zawodowego jako czynnika różnicującego pielęgniarki czynne zawodowo [8]. W ostatniej części badań skupiono się na wpływie poziomu empatii na stopień wypalenia zawodowego. W większości przy-

281

padków analiza przeprowadzonych badań potwierdziła wpływ empatii na poziom syndromu wypalenia zawodowego. W wyniku przeprowadzonych badań zauważono trzy znaczące korelacje pomiędzy empatią a wypaleniem zawodowym wśród pielęgniarek pracujących w ośrodku onkologicznym. Odnotowano na poziomie średnim poczucie braku osobistych osiągnięć i przyjmowanie perspektywy. W korelacji niskiej – wyczerpanie emocjonalne i osobistą przykrość oraz depersonalizację i osobistą przykrość. Zauważono, iż ze wzrostem wyników poczucia braku osobistych osiągnięć malały wyniki przyjmowania perspektyw, natomiast najwyższe wyniki osobistej przykrości osiągały pielęgniarki o umiarkowanych wynikach wyczerpania emocjonalnego, najniższe o niskich wynikach wyczerpania emocjonalnego. Jednak wraz ze wzrostem wyników depersonalizacji wzrastały wyniki osobistej przykrości. Wilczek-Rużyczka [5], badając podobne zależności, twierdzi, że w odpowiedzi na pytanie, czy istnieją powiązania między empatią a wypaleniem zawodowym pojawiają się wątpliwości. Rozpatrując współzależne innymi narzędziami niż IRI Davisa, autorka stwierdza, iż w nie każdym przypadku i nie dla wszystkich komponentów udało się je istotnie potwierdzić. Do zbliżonych wniosków doszły badaczki spoza kraju, Saulé Raiziené, Auksé Endriulaitiené w 2007 roku [9], które przeprowadzając podobne badania wśród pielęgniarek kilku litewskich szpitali doszły do konkluzji, że przeprowadzone pomiary nie dostarczają jasnych odpowiedzi dotyczących relacji pomiędzy empatią a wypaleniem zawodowym. Jednakże autorki wnioskują, że silne zaangażowanie zawodowe ma duży wpływ na wypalenie zawodowe, szczególnie na wyczerpanie emocjonalne. Podsumowując powyższe badania, można uznać istnienie związku pomiędzy empatią a wypaleniem zawodowym u pielęgniarek onkologicznych. Wraz ze wzrostem wyników w skali osobistych dokonań i ewentualnym spadkiem wyczerpania emocjonalnego oraz depersonalizacji spada poziom wypalenia zawodowego. Można również potwierdzić istnienie różnic w poziomie empatii i stopnia wypalenia zawodowego u pielęgniarek zatrudnionych na stanowiskach o różnorodnej specyfice. Wnioski 1. Pielęgniarki onkologiczne w zależności od specyfiki pracy jaką wykonują, nieznacznie różnią się zarówno poziomem empatii, jak i stopniem wypalenia zawodowego. Różnicują je składowe empatii. Większość charakteryzuje tendencja do empatyzowania, czyli doświadczenia uczuć ciepła, sympatii i współczucia w kontaktach z innymi ludźmi, szczególnie z pacjentami, natomiast wykazują niewielką skłonność do wczuwania się w role postaci fikcyjnych. 2. Wykazują umiarkowaną skłonność do wypalenia zawodowego, chociaż nasilenie tego zjawiska uwarunkowane jest również rodzajem wykonywanej pracy. Najbardziej wypalone zawodowo czują się pielęgniarki z przychodni, wyróżniające się najwyższą średnią wiekową. Najmniej symptomów wypalenia wykazują pielęgniarki oddziałów

PRACE ORYGINALNE

282

Krystyna Kurowska, Anna Zuza-Witkowska

zachowawczych, których średnia wieku jest zbliżona, a staż pracy w szpitalu jest najkrótszy. 3. Pielęgniarki oddziałów zachowawczych cechuje także najwyższy poziom empatii, co może być spowodowane charakterem pracy, jako bardziej zorganizowanej, statycznej, w przeciwieństwie do pracy dynamicznej, w ciągłym pośpiechu pielęgniarek oddziałów zabiegowych. Taka swoistość pracy pozwala na dłuższy kontakt i komunikację z pacjentem. 4. Większość badanych kobiet uważa, iż atmosfera w pracy, wzajemne relacje współpracowników wpływają zarówno na ich samopoczucie, jak i życie osobiste. Piśmiennictwo 1. Dębska G., Cepuch G.: Wypalenie zawodowe u pielęgniarek pracujących w zakładach podstawowej opieki zdrowotnej. Problemy Pielęgniarstwa, 2008, 16 (3), 274. 2. Davis M.H.: Empatia. O umiejętności współodczuwania. Gdańskie Wydawnictwo Psychologiczne, Gdańsk 2001, 14-16. 3. Pasikowski T.: Polska adaptacja kwestionariusza Maslach Burnout Inventory. [w:] Wypalenie zawodowe. Przyczyny. Mechanizmy. Zapobieganie, Sęk H. (red.). PWN, Warszawa 2000, 13-31, 135-148. 4. Orzechowska A., Talarowska M., Drozda R., Mirowska D., Florkowski A., Zboralski K., Gałecki P.: Zespół wypalenia zawodowego u lekarzy i pielęgniarek. Polski Merkuriusz Lekarski, 2008, 25, 150-155.

PRACE ORYGINALNE

5. Wilczek-Rużyczka E., Plew Z.: Wypalenie zawodowe u pracowników ochrony zdrowia. Medycyna Rodzinna, 2008, 3, 69-73 6. Pytka D., Doboszyńska A., Kądalska E., Sienicka A.: Wypalenie zawodowe pielęgniarek pracujących w wybranych hospicjach stacjonarnych województwa mazowieckiego. Medycyna Paliatywna w Praktyce, 2010, 4(3), 106-110. 7. Lewandowska A., Litwin B.: Wypalenie zawodowe jako zagrożenie w pracy pielęgniarki. Annales Academiae Medicae Stetinensis. Roczniki Pomorskiej Akademii Medycznej w Szczecinie, 2009, 55(3), 86-89. 8. Kurowska K., Maciaszek A., Haor B., Rezmerska L.: Poczucie koherencji a wypalenie u czynnych zawodowo pielęgniarek. Pielęgniarstwo Chirurgiczne i Angiologiczne, 2011, 1, 23-27. 9. Raiziene S.; Endriulaitiene A.: The relations among empathy, occupational commitment, and emotional exhaustion of nurses. Medicina-Lithuania, 43, 5, 425-431.

Adres do korespondencji: Kurowska Krystyna – dr n med.; Katedra i Zakład Pedagogiki i Dydaktyki Pielęgniarskiej CM w Bydgoszczy, UMK Toruń; 85-801 Bydgoszcz, ul. Techników 3, tel.: 52/585-21-94; e-mail: [email protected]

Nowiny Lekarskie 2011, 80, 4, 283–287

BARTOSZ FRYCZ, ALICJA PINCZEWSKA, PAWEŁ P. JAGODZIŃSKI

MAŚLAN SODU OBNIŻA EKSPRESJĘ DEHYDROGENAZY 17β-HYDROKSYSTEROIDOWEJ TYPU 1-SZEGO W LINII KOMÓRKOWEJ RAKA GRUCZOŁU KROKOWEGO LNCaP SODIUM BUTYRATE DECREASES 17β-HYDROXYSTEROID DEHYDROGENASE TYPE 1 EXPRESSION IN LNCaP PROSTATE CANCER CELL LINE Katedra i Zakład Biochemii i Biologii Molekularnej Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Kierownik: prof. dr hab. Paweł P. Jagodziński

Streszczenie Wstęp. Endogenne hormony steroidowe zaliczane są do czynników mających wpływ na rozwój raka gruczołu krokowego, aczkolwiek ich rola w tym procesie nadal pozostaje niejasna. Jedną z grup hormonów regulujących wzrost gruczołu krokowego są estrogeny, które prawdopodobnie również uczestniczą w procesie kancerogenezy tego narządu. Synteza estrogenów może zachodzić lokalnie w tkance gruczołu krokowego. Proces ten jest możliwy dzięki ekspresji genów kodujących enzymy szlaku steroidogenezy w komórkach stercza. Zachodzące w trakcie nowotworzenia zmiany ekspresji genów mogą prowadzić do powstawania nieprawidłowych ilości estrogenów w tkance gruczołu krokowego i tym samym modulować jego kancerogenezę. Jedną z dróg regulacji ekspresji genów zachodzącą w komórkach eukariotycznych są mechanizmy epigenetyczne. Zalicza się do nich zmiany w strukturze chromatyny wywołane m.in. acetylacją białek histonowych. Jedną z metod badań tychże zmian jest wykorzystanie maślanu sodu, będącego inhibitorem deacetylaz histonowych, który hamuje kondensację chromatyny wywołaną aktywnością tych enzymów. Cel. Celem pracy było zbadanie wpływu maślanu sodu na ekspresję genu HSD17β1 w liniach komórkowych raka gruczołu krokowego LNCaP, kodującego enzym dehydrogenazę 17β-hydroksysteroidową typu 1-szego, odpowiedzialną za konwersję słabo aktywnego biologicznie estronu w najbardziej czynną formę estrogenów, 17β estradiol. Materiały i metody. Komórki linii LNCaP poddano 72-godzinnej inkubacji zarówno bez, jak i w obecności maślanu sodu. Potencjalne działanie cytotoksyczne maślanu sodu na hodowle komórkowe zbadano, wykorzystując w tym celu test z 3-(4,5-dimetylotiazol-2-yl)-25-difenylobromkiem tetrazoliny (MTT). Dokonano również pomiaru poziomu transkryptu genu HSD17β1 z wykorzystaniem techniki łańcuchowej reakcji polimerazy w czasie rzeczywistym oraz poziomu białka za pomocą techniki wetsern blot. Wyniki. Maślan sodu powodował obniżenie poziomu białka i transkryptów HSD17β1 w liniach komórkowych raka gruczołu krokowego LNCaP. Wnioski. Maślan sodu obniża ekspresję HSD17β1, co mogłoby przyczynić się do śródkomórkowego obniżenia poziomu estriadiolu w tkance raka gruczołu krokowego. Dlatego też związek ten mógłby wykazywać działanie terapeutyczne szczególnie w androgenoniezależnej fazie wzrostu guza. Jednakże niezbędna jest większa ilość badań na temat udziału maślanu sodu w szlaku produkcji estrogenów w raku stercza. SŁOWA KLUCZOWE: rak stercza, maślan sodu, acetylacja histonów, HSD17β1.

Summary Introduction. Endogenous sex hormones are involved in prostate cancer progression, however mechanisms of this process are still obscure. Estrogens regulate growth of normal prostate cells and may participate in their carcinogenesis. Estrogens can be locally produced by protein product expression of genes encoding steroidogenic enzymes in prostate tissue. Changes in the expression of steroidogenic enzymes during malignancy may lead to altered estrogens concentration in prostate tissue and thus regulate tumor growth. Gene expression in eukaryotic cells may be regulated by epigenetic mechanisms such as histone acetylation. This process can be investigated in prostate cancer cell lines using histone deacetylases inhibitor, sodium butyrate. Sodium butyrate inhibits chromatin remodeling by suppressing histone deacetylases action. Aim of study. Aim of study was to investigate influence of sodium butyrate on HSD17β1 gene expression in LNCaP prostate cancer cell line. HSD17β1 encodes 17β-hydroxysteroid dehydrogenase type 1 which is involved in conversion of biologically weak estrone to the most potent form of estrogens, 17β-estradiol. Materials and methods. LNCaP cell line was incubated for 72 hours in the abscence or in the presence of sodium butyrate at different concentration. We determined potential cytotoxic effect of sodium butyrate on cell culture with 3-(4,5-Dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide assay (MTT). HSD17β1 transcript level was estimated using real time polymerase chain reaction and protein amount was assessed using western blot analysis. Results. Sodium butyrate decreased 17β-hydroxysteroid dehydrogenase type 1 expression in LNCaP prostate cancer cell line. Conclusions. Sodium butyrate decreases HSD17β1 expression. It may lead to lower intracellular estradiol production. Sodium butyrate may carry terapeutic potential in androgen resistant stage of prostate cancer. However, we need to determine in more detail the effect of sodium butyrate on estrogen metabolism pathways in prostate cancer. KEY WORDS: prostate cancer, sodium butyrate, histones acetylation, HSD17β1.

PRACE ORYGINALNE

284

Bartosz Frycz i inni

Wstęp Rak gruczołu krokowego jest jednym z najczęstszych nowotworów złośliwych dotykających mężczyzn w krajach zachodnich. Molekularne przyczyny rozwoju tej choroby wciąż pozostają słabo poznane, aczkolwiek wyodrębniono kilka czynników ryzyka zwiększających prawdopodobieństwo jej wystąpienia. W regulacji prawidłowego wzrostu komórek gruczołu krokowego (stercza) biorą udział hormony steroidowe, które prawdopodobnie również uczestniczą w procesie nowotworzenia w tym narządzie [1]. Wiele kontrowersji budzą estrogeny, których podawanie dawniej stanowiło metodę leczenie raka gruczołu krokowego [2]. Obecnie natomiast hormony te wskazywane są jako jeden z czynników stymulujących rozwój tej choroby [3]. Co więcej, ilość estrogenów w tkance stercza warunkowane jest lokalną aktywnością enzymów szlaku steroidogenezy, które katalizują reakcję przekształcania dostarczanych drogą krwi prekursorów w aktywne hormony steroidowe [4]. Dlatego też poziom ekspresji genów kodujących enzymy uczestniczące w formowaniu estrogenów może mieć istotne znaczenie ze względu na swój pośredni wpływ na ilość tych hormonów w tkance. To z kolei może być związane z modulacją wzrostu guza. Jednym z mechanizmów regulacji ekspresji genów, leżącym w obrębie zainteresowań epigenetyki, są chemiczne modyfikacje N-końcowych ogonów białek histonowych. Wśród tych modyfikacji występuje acetylacja, która wpływa na strukturę i funkcje chromatyny [5]. Acetylacja ogonów histonowych ogranicza fałdowanie się chromatyny w struktury wyższego rzędu [6], najprawdopodobniej poprzez hamowanie oddziaływań pomiędzy histonami a innymi białkami oraz DNA [7]. Proces ten nasila transkrypcje genów poprzez rozluźnienie struktury chromatyny, co zwiększa dostępność do DNA dla polimerazy i czynników transkrypcyjnych [8]. Stan acetylacji histonów regulowany jest aktywnością dwóch grup enzymów: acetylotransferaz histonowych (HATs) oraz deacetylaz histonowych (HDACs). Działanie HATs wiąże się z hiperacetylacją białek histonowych i tym samym ze wzmożoną aktywnością transkrypcyjną, podczas gdy deacetylacja wywołana aktywnością HDACs osłabia transkrypcję genów [9]. W badaniach nad mechanizmami regulacji ekspresji genów kontrolowanych poziomem acetylacji histonów, wykorzystuje się aktywność wielu związków, które wpływają na aktywność HATs i HDACs. Jednym z takich związków jest maślan sodu, należący do grupy krótkołańcuchowych kwasów tłuszczowych. Maślan sodu syntetyzowany jest przez bakterie bytujące w jelicie grubym, które jako substrat do jego produkcji wykorzystują błonnik pokarmowy [10]. Będąc inhibitorem enzymów HDACs, maślan sodu zwiększa poziom acetylacji białek pistonowych, wpływając tym samym na wzmocnienie transkrypcji wielu genów [11]. Istotne znaczenie dla śródkomórkowego stężenia hormonów steroidowych w sterczu może mieć ekspresja genu HSD17β1 kodującego dehydrogenazę 17β-hydroksy-steroidową typu 1-szego, odpowiedzialną za konwersję mało aktywnego biologicznie estronu (E1) w najbardziej aktywną formę estrogenów 17β-estradiolu (E2). Niniejsza praca ma na celu zbadanie wpływu maślanu sodu na ekspresję genu

PRACE ORYGINALNE

HSD17β1 w liniach komórkowych raka gruczołu krokowego LNCaP. Materiały i metody Kozie przeciwciało poliklonalne anty-HSD17β1, ośle przeciwciało antykozie skoniugowane z enzymen peroksydazy chrzanowej (HRP) oraz przeciwciało poliklonalne dla β-aktyny zakupiono w Santa Cruz Biotechnology (Santa Cruz, CA). Maślan sodu zakupiony został w Sigma-Aldrich Co. (St. Louis, MO).

Hodowla komórkowa Linia raka gruczołu krokowego LNCaP otrzymana została od American Type Culture Collection (Rockville, MD). Hodowle prowadzono w medium RPMI-1640 (Sigma-Aldrich, CO) z dodatkiem 10% bydlęcej surowicy płodowej (FBS) inaktywowanej termicznie. Wpływ maślanu sodu na poziom białka HSD17β1 oznaczono poprzez 24-godzinną hodowlę komórek linii LNCaP w medium RPMI-1640 pozbawionym czerwieni fenolowej i o 10% objętości FBS. Komórki hodowano bez, jak i w obecności maślanu sodu w stężeniach: 0,5, 1 i 1,5 mM w czasie 72 godzin oraz przy zachowaniu stałych parametrów powietrza (95%) i dwutlenku węgla (5%) w temperaturze 37 °C. Test cytotoksyczności Potencjalne działanie cytotoksyczne maślanu sodu na komórki linii LNCaP oceniono za pomocą testu z 3(4,5-dimetylotiazol-2-yl)-2-5-difenylobromkiem tetrazoliny (MTT). Przez 24 godziny przed przystąpieniem do eksperymentu, komórki hodowano w medium RPMI-1640 bez czerwieni fenolowej, z dodatkiem surowicy pozbawionej hormonów. Następnie komórki wysiano na płytki 24-dołkowe w ilości 4x104 komórek na każdy dołek i pozostawiono na 24 godziny. Po tym czasie podano świeże medium RPMI-1640 bez czerwieni fenolowej i 10% zawartości FBS pozbawionej hormonów, zawierające maślan sodu w stężeniach: 0; 0,5; 1,5 mM. Po 72 godzinach do hodowli dodano 50 µl odczynnika MTT stanowiącego 10% objętości RPMI-1640 bez surowicy, a następnie pozostawiono do 4-godzinnej inkubacji. Wytrącone z komórek kryształy formazanu zostały rozpuszczone w 150 µl mieszaniny 0.1n HCl z izopropanolem. Następnie zmierzono absorbancję powstałego roztworu za pomocą spektrofotometru Stat Fax 2100 przy długości fali 550 nm. Produkcja kryształów formazanu zachodzi jedynie w mitochondriach żywych komórek, dlatego też poziom absorbancji koreluje z żywotnością komórek. Western blot Wpływ maślanu sodu na poziom białka HSD17β1 w linii komórkowej LNCaP oszacowano z wykorzystaniem techniki western blot. W tym celu komórki hodowano przez okres 72 godzin w RPMI-1640 bez czerwieni fenolowej, przy braku, jak i w obecności maślanu sodu w stężeniach: 0,5; 1 i 1,5 mM. Po tym czasie z komórek wyizolowano białko całkowite, wykorzystując bufor RIPA (50 mM Tris-

Maślan sodu obniża ekspresję dehydrogenazy 17β-hydroksysteroidowej typu 1-szego w linii komórkowej raka gruczołu … 285

HCl, pH 8.0, 150 mM chlorek sodu, 1.0%, Igepal CA-630, 0,5% dezoksycholan sodu, 0,1% sól sodowa siarczanu dodecylu i inhibitor proteaz). Na każdą ścieżkę żelu poliakrylamidowego naniesiono po 40 µg białka zawieszonego w buforze obciążającym i poddano elektroforezie w warunkach denaturujących, zachowanych dzięki obecności soli sodowej siarczanu dodecylu. Następnie przeprowadzono elektrotransfer białek na membranę z polifluorku winylu (PVDF), którą blokowano przez godzinę w 5% mleku w buforze Tris/HCl/Tween. Wizualizację prążków białek na membranie osiągnięto poprzez zastosowanie koziego przeciwciała anty-HSD17β1 a następnie oślego przeciwciała antykoziego związanego z HRP. W celu detekcji sygnału zastosowano zestaw ECL i Supersignal West Femto (Thermo Scientific, Rockford Il). Poziom białka HSD17β1 znormalizowano względem poziomu białka referencyjnego β-aktyny.

Reakcja odwrotnej transkrypcji (RT-PCR) i łańcuchowej reakcji polimerazy w czasie rzeczywistym (rt-PCR) W celu określenia wpływu maślanu sodu na poziom transkryptów genu HSD17β1, komórki LNCaP hodowano przez okres 72 godzin z maślanem sodu o stężeniu 0 i 1,5 µM. Całkowite RNA wyizolowano metodą Chomczyńskiego i Sacchi [12]. Syntezę cDNA na matrycy RNA wykonano za pomocą RT-PCR. Ilościową analizę cDNA HSD17β1 wykonano z użyciem systemu RQ-PCR Sybr Green I Light Cycler, Roche Diagnostic GmbH. Ilość transkryptów genu HSD17β1 każdej próby wystandaryzowano względem poziomu cDNA genu referencyjnego kodującego białko L19 podjednostki 50S rybosomów mitochondrialnych (hMRPL19). Amplifikację cDNA genów HSD17β1 i hMRPL19 przeprowadzono wykorzystując sekwencje starterowe zamieszczone w tabeli 1. Do amplifikacji genu HSD17β1 użyto 1µl cDNA natomiast do hMRPL19 0,5 µl cDNA, które dodano odpowiednio do 9 µl i 9,5 µl mieszaniny reakcyjnej IQTM Sybr® Green Supermix Bio-Rad zawierającej 10 µM startery. Wyznaczona z krzywej wzorcowej względna liczba kopii transkryptów genu HSD17β1 przeliczona została na równą ilość kopii genu hMRPL19. Tabela 1. Sekwencje starterowe dla genów HSD17β1 oraz hMRPL19 użyte w rt-PCR Table 1. Primer sequences for HSD17β1 and hMRPL19 genes, used in rt-PCR Gen HSD17β1

hMRPL19

Sekwencja starterowa F: 5' TGAGGAGGTGGCGGAGGTCTTC 3' R: 5' CGCTCGGTGGTGAAGTAG 3' F: 5' ACTTTCAGCTCATTAACAG 3' R: 5' ACTTTATAATCCTCGGGTC 3'

Analiza statystyczna Istotność statystyczną (p < 0,05) oznaczono za pomocą analizy wariancji. Porównań dokonano za pomocą testu t-studenta z założeniem rozkładu dwustronnego.

Wyniki

Oznaczenie cytotoksyczności maślanu sodu Czas inkubacji oraz dawkę efektywną maślanu sodu ustalono na podstawie innych badań [11]. Stężenie maślanu sodu użyte w doświadczeniu nie miało działania cytotoksycznego na komórki (Ryc. 1). Nie wykazano istotności statystycznej w żywotności pomiędzy komórkami inkubowanymi bez, jak i w obecności maślanu sodu.

Rycina 1. Zależność żywotności komórek od użytej dawki maślanu sodu w stężeniu: 0 (próba kontrolna); 0,5; 1,5 mM po 72-godzinnej inkubacji. Słupki wykresu wyrażają średnie wartości absorbancji, uzyskane w teście MTT, wraz z zaznaczonym odchyleniem standardowym. Figure 1. Effect of sodium butyrate at concentrations of: 0 (control); 0,5; 1,5 mM on LNCaP cells viability, after 72 hours of incubation. Columns represent mean value of absorbance obtained in MTT assay with marked standard deviation.

Maślan sodu obniża poziom transkryptu oraz białka HSD17β1 w linii komórkowej LNCaP

Rycina 2. Maślan sodu obniża poziom transkryptów genu HSD17β1 w linii komórkowej raka gruczołu krokowego LNCaP. Komórki hodowano przez 72 godziny w medium RPMI1640 pozbawionym czerwieni fenolowej przy braku, jak i w obecności maślanu sodu w stężeniu 1,5 mM. Po skończonej inkubacji z komórek wyizolowano całkowite RNA, a następnie wykonano reakcję odwrotnej transkrypcji. Poziom cDNA dla HSD17β1 oznaczono ilościowo za pomocą reakcji łańcuchowej polimerazy w czasie rzeczywistym oraz wystandaryzowano względem poziomu cDNA genu referencyjnego kodującego białko L19 podjednostki 50S rybosomów mitochondrialnych. Wyznaczona z krzywej wzorcowej względna liczba kopii transkryptów genu HSD17β1 przeliczona została na równą ilość kopii genu hMRPL19. Każda z prób wykonana została w trzech powtórzeniach a wyniki zaprezentowano jako średnią ±SEM z trzech eksperymentów. p < 0,05.

PRACE ORYGINALNE

286

Bartosz Frycz i inni

Figure 2. Sodium butyrate induced decrease of transcript level in prostate cancer cell line LNCaP. Cells were incubated for 72 hours in RPMI-1640 phenol free medium in absence or sodium butyrate present at 1,5 mM concentration. After incubation total RNA was isolated from the cells and reverse transcription reaction was performed. HSD17β1 cDNA level was determined by using real-time polymerase chain reaction and standarised by the human mitochondrial ribosomal protein L19 cDNA level. Using standard curve relative amounts of HSD17β1 transricpt copies were calculated on corresponding hMRPL19 transcripts amount. Each sample was tested thrice and presented results are mean value ±SEM from three experiments p < 0.05.

Analiza densytometryczna białka HSD17β1 wykazała spadek jego ilości zależny od dawki maślanu sodu (Rycina 3). Spadek ten korelował z obniżonym poziomem transktyptów dla genu HSD17β1 (Rycina 2).

Rycina 3. Maślan sodu obniża poziom białka HSD17β1 w zależności od użytej dawki. Elektroforezę białek wykonano w 10% żelu poliakrylamidowym w obecności soli sodowej siarczanu dodecylu a następnie przeprowadzono ich elektrotransfer z żelu na membranę PVDF. Membranę po uprzednim blokowaniu poddano inkubacji z kozim przeciwciałem poliklonalnym anty-HSD17β1, a następnie oślim przeciwciałem antykozim skoniugowanym z enzymem HRP. W celu analizy poziomu białka referencyjnego, β-aktyny, membranę inkubowano z przeciwciałem anty-βaktyna skoniugowanym z HRP. Poziom białka HSD17β1 w poszczególnych próbach znormalizowano względem β-aktyny. Wartość próby inkubowanej bez obecności maślanu sodu przyjęto jako 1. Figure 3. Sodium butyrate, in concentration dependent manner, decreased HSD17β1 protein level. Protein electrophoresis was performed in 10% poliacrylamide gel in sodium dodecyl sulfate presence. After electrophoresis process proteins were electrotransferred on PVDF membrane. Membranes were incubated with blocking solution and goat policlonal antibody anti-HSD17β1 and, then, with donkey antibody anti-goat conjugated with HRP enzyme. Levels of HSD17β1 protein were normalized to corresponding β-actin level. For untreated sample (control) the ratio of HSD17β1 to β-actin was assumed to be 1.

Dyskusja W 1941 roku Huggins i Hodges w swoich badaniach zaobserwowali spadek kwaśnej fosfatazy w surowicy pacjentów chorych na raka stercza, którzy uprzednio przeszli zabieg kastracji lub terapię antyandrogenem [13]. Enzym ten był jedynym ówcześnie znanym biomarkerem, którego podwyższony poziom w surowicy mógł być związany z procesem nowotworzenia w gruczole krokowym [14]. U osób z zaawansowanym rakiem stercza wzrost poziomu kwaśnej fosfatazy następował również w wyniku podawania androgenów. Obserwacje

PRACE ORYGINALNE

te nagrodzone w późniejszym czasie nagrodą Nobla, wskazały na testosteron jako główny czynniki napędzający rozwój raka stercza oraz dały początek terapii mającej na celu blokowanie jego syntezy. Jedną z pierwszych metod hormonalnego leczenia pacjentów z zaawansowanym rakiem prostaty było podawanie estrogenów [15]. Najprawdopodobniej poprzez wpływ na oś podwzgórzeprzysadka-gonady, estrogeny przyczyniały się do spadku syntezy testosteronu, co początkowo przynosiło pozytywny efekt kliniczny w postaci cofania się guza [16]. Niestety z biegiem czasu w większości przypadków komórki rakowe nabywają cech androgenoniezależnych i zdolne są do wzrostu zarówno w obecności, jak i przy braku testosteronu [17]. Chociaż estrogeny stosowano jako formę terapii dla raka gruczołu krokowego, wiele badań sugeruje ich udział w napędzaniu rozwoju tej choroby. W modelu zaproponowanym przez Friedmana [18] estradiol jest niezbędny do inicjacji wzrostu raka stercza poprzez formowanie telomerów. Estrogeny stymulowały podziały komórek prawidłowych oraz linii LNCaP [19]. W badaniach in vivo hormony te nasilały proliferujące działanie androgenów w stosunku do komórek stercza [20]. Długotrwałe podawanie estradiolu wraz z testosteronem u szczurów rasy Noble skutkowało zwiększoną częstotliwością występowania gruczolakoraków w grzbietowo-bocznej części gruczołu krokowego [21]. Wyniki naszych badań wskazują na wpływ maślanu sodu na obniżenie poziomu dehydrogenazy 17β-hydroksysteroidowej typu 1-szego w hormonozależnej linii komórkowej raka stercza LNCaP. Enzym HSD17β1 odgrywa istotną rolę w formowaniu aktywnego biologicznie 17β-estradiolu z estronu oraz prekursora testosteronu Δ5-androsterono-3β,17β-diolu z dehydropiandrosteronu. Śródkomórkowe obniżenie poziomu tego enzymu w sterczu mogłoby wpływać na zmniejszenie ilości hormonów steroidowych i osłabić wzrost guza. Efekt ten byłby szczególnie przydatny w fazie andogenoniezależnej, w której to stymulacja wzrostu komórek nowotworowych zachodzi prawdopodobnie pod wpływem estrogenów. Pogląd ten wspierają obserwacje, w których stwierdzono wzrost ekspresji genów odpowiedzialnych m.in. za formowanie aktywnych estrogenów podczas tej fazy. Jednocześnie zanotowano spadek ekspresji genów, których produkty uczestniczą w inaktywacji aktywnych hormonów steroidowych [22]. Wnioski W przeprowadzonych badaniach maślan sodu powodował spadek ekspresji dehydrogenazy 17β-hydroksysteroidowej typu 1-szego w liniach komórkowych raka gruczołu krokowego LNCaP. Proces ten mogłoby wiązać się z śródkomórkowym obniżeniem produkcji estradiolu, a tym samym z ograniczeniem podziałów komórek stercza indukowanych tym hormonem. Niestety rola hormonów steroidowych w procesie kancerogenezy gruczołu krokowego pozostaje nadal niejasna i wymaga większej ilości badań.

Maślan sodu obniża ekspresję dehydrogenazy 17β-hydroksysteroidowej typu 1-szego w linii komórkowej raka gruczołu … 287

Piśmiennictwo 1. Marker P.C., Donjacour A.A., Dahiya R., Cunha G.R.: Hormonal, cellular, and molecular control of prostatic development. Dev. Biol., 2003, 253, 165-174. 2. Cox R.L., Crawford E.D.: Estrogens in the Treatment of Prostate Cancer. J. Urol., 1995, 154, 6, 1991-8. 3. Carruba G.: Estrogen and prostate cancer: an eclipsed truth in an androgen-dominated scenario. J. Cell Biochem., 2007, 1, 102, 4, 899-911. 4. Pfeiffer M.J., Smit F.P., Sedelaar J.P., Schalken J.A.: Steroidogenic enzymes and stem cell markers are upregulated during androgen deprivation in prostate cancer. Mol. Med., 2011, 17, 7-8, 657-64. 5. Pogo B.G., Allfrey V.G., Mirsky A.E.: RNA synthesis and histone acetylation during the course of gene activation in lymphocytes. Proc. Natl. Acad. Sci. U.S.A., 1966, 55, 805812. 6. Garcia-Ramirez M., Rocchini C., Ausio J.: Modulation of chromatin folding by histone acetylation. J. Biol. Chem., 1995, 270, 17923-17928. 7. Covault J., Chalkley R.: The identification of distinct populations of acetylated histone. J. Biol. Chem., 1980, 255, 9110-9116. 8. Tse C., Sera T., Wolffe A.P., Hansen J.C.: Disruption of higher order folding by core histone acetylation dramatically enhances transcription of nucleosomal arrays by RNA polymerase III. Mol. Cell. Biol., 1998, 18, 4629-4638. 9. de Ruijter A.J., van Gennip A.H. et al.: Histone deacetylases (HDACs): characterization of the classical HDAC family. Biochem. J., 2003, 370, 737-749. 10. Scharlau D., Borowicki A. et al.: Mechanisms of primary cancer prevention by butyrate and other products formed during gut flora-mediated fermentation of dietary fibre. Mutat. Res., 2009, 682, 1, 39-53. 11. Candido E. P. M., Reeves R., Davie J. R.: Sodium butyrate inhibits histone deacetylation in cultured cells. Cell, 1978, 14, 105-113. 12. Chomczynski P., Sacchi N.: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Anal. Biochem., 1987, 162, 156-159.

13. Zelivianski S., Dean J., Madhavan D., Lin F.F., Lin M.F.: Expression of receptor protein tyrosine phosphatase alpha mRNA in human prostate cancer cell lines. Mol. Cell. Biochem., 2000, 208, 11-18. 14. Huggins C., Hodges C.V.: Studies of prostatic cancer: effect of castration, estrogen and androgen injections on serum phosphatases in metastatic carcinoma of the prostate. Cancer Res., 1941, 1, 293-297. 15. Taira A., Merrick G.., Wallner K., Dattoli M.: Reviving the acid phosphatase test for prostate cancer. Oncology, 2007, 21, 8, 1003-10. 16. Harkonen P.L., Makel S.I.: Role of estrogens in development of prostate cancer. J. Steroid Biochem. Mol. Biol., 2004, 92, 4, 297-305. 17. Bianco J., Handelsman D., Pedersen J., Risbridger G.: Direct response of the murine prostate gland and eminal vesicles to estradiol. Endocrinology, 2002, 143, 12, 4922-33. 18. Friedman A.E.: The Estradiol-Dihydrotestosterone model of prostate cancer. Theor. Biol. Med. Model., 2005, 2-10. 19. Castagnetta L.A., Granata O.M. et al.: Product of aromatase activity in intact LNCaP and MCF-7 human cancer cells. J. Steroid Biochem. Mol. Biol., 1997, 61, 287-292. 20. Suzuki K., Ito K., Suzuki T., Honma S., Yamanaka H.: Synergistic effects of estrogen and androgen on the prostate: effects of estrogen on androgen- and estrogen-receptors, BrdU uptake, immunohistochemical study of AR, and responses to antiandrogens. Prostate, 1995, 26, 151-163. 21. Noble R.L.: The development of prostatic adenocarcinoma in Nb rats following prolonged sex hormone administration. Cancer Res., 1977, 37, 1929-1933. 22. Koh E., Noda T., Kanaya J. et al.: Differential expression of 17beta-hydroxysteroid dehydrogenase isozyme genes in prostate cancer and noncancer tissues. Prostate, 2002, 53, 2, 154-159. Adres do korespondencji: Katedra i Zakład Biochemii i Biologii Molekularnej Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu ul. Święcickiego 6 Poznań

PRACE ORYGINALNE

Nowiny Lekarskie 2011, 80, 4, 288–294

KATARZYNA KAŹMIERCZAK, MARIAN MAJCHRZYCKI, WANDA STRYŁA

ROZKŁAD ZALECONYCH ZABIEGÓW W REHABILITACJI PACJENTÓW PO URAZIE CZASZKOWO-MÓZGOWYM W ZALEŻNOŚCI OD STOPNIA URAZU WG GLASGOW COMA SCALE SCHEDULE OF RECOMMENDED PROCEDURES IN THE REHABILITATION OF PATIENTS AFTER TBI IN RESPECT TO THE LEVEL OF TRAUMA ACCORDING TO GLASGOW COMA SCALE Katedra i Klinika Rehabilitacji Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Kierownik: prof. dr hab. n. med. Wanda Stryła

Streszczenie Wstęp. Urazy czaszkowo-mózgowe są jedną z przyczyn zgonów i niepełnosprawności w Polsce. Ich następstwem są zaburzenia motoryczne i zmiany o charakterze neuropsychologicznym. Wczesna rehabilitacja ruchowa znacząco wpływa na dalszy stan zdrowia osób po urazie czaszkowo-mózgowym. Cel. Celem pracy jest przedstawienie i przeanalizowanie programu rehabilitacji, stosowanego w Ortopedyczno-Rehabilitacyjnym Szpitalu Klinicznym im. W. Degi w Poznaniu u pacjentów po przebytym urazie czaszkowo-mózgowym. Materiał i metody. Grupę badanych stanowiły 54 osoby (k = 21 i m = 33), które doznały średniego lub ciężkiego urazu czaszkowomózgowego. Do oceny ciężkości urazu posłużyła skala nieprzytomności Glasgow (Glasgow Coma Scale – GCS). Badania oparto na analizie dokumentacji medycznej badanych osób oraz raporcie stosowanych zabiegów rehabilitacyjnych w ORSK nr 4 im. W. Degi w Poznaniu. Wyniki. U badanych osób stosowano zabiegi kinezyterapii, kształtowania lokomocji, przeciwbólowe, ćwiczenia i zabiegi zmniejszające spastyczne napięcie mięśni oraz stymulujące mięśnie niedowładne. W celu poprawy funkcji manulanych stosowano ćwiczenia w terapii zajęciowej a u pacjentów zaburzeniami mowy ćwiczenia logopedyczne. Wnioski. Stosowane programy terapeutyczne nastawione są głównie na usprawnianie fizyczne i ograniczenie u pacjenta po urazie czaszkowo-mózgowym istniejących dolegliwości motorycznych. W wykorzystywanych zabiegach widoczne są różnice w zależności od stopnia urazu, ocenianego wg Glasgow Coma Scale. SŁOWA KLUCZOWE: uraz czaszkowo-mózgowy, rehabilitacja, skala GCS.

Summary Introduction. Traumatic Brain Injuries (TBIs) are one of the causes of death and disability in Poland. Consequences of TBI are motor disorders and neuropsychological changes. Early motor rehabilitation greatly influences subsequent health condition of persons after TBI. Aim. The aim of the study was presentation and analysis of rehabilitation program, used in 4th Orthopedic Hospital in Poznan in the group of patients after TBI. Methods. Control group was composed of 54 persons (w = 21, m = 33), who experienced moderate or severe brain injury. Glasgow Coma Scale (GCS) was used to assess the severity of trauma. The study was based on the analysis of patients medical documentation and on the report of performed rehabilitation procedures. Results. During hospitalization patients rehabilitation program was based on kinesiotherapy, analgetic procedures, locomotion exercises, procedures directed to reduction of muscle spasticity and procedures stimulating paretic muscles. To improve manual functions occupational therapy was used. Patients with speech disorders took part in speech therapy exercises. Conclusion. Exercises used in rehabilitation are aimed mainly at improving the physical and restriction motor disorders. The procedures used depend on the severity of trauma assessed by Glasgow Coma Scale. KEY WORDS: Traumatic Brain Injury, rehabilitation, Glasgow Coma Scale.

Wstęp Urazy czaszkowo-mózgowe (UCM) są jedną z głównych przyczyn, po nowotworach i chorobach układu krążenia, zgonów mężczyzn w młodym wieku i przyczyną niepełnosprawności ludzi w Polsce [1]. Do urazów dochodzi najczęściej podczas wypadków komunikacyjnych, a ich konsekwencje w większości rzutują na zmiany w dalszym życiu osoby poszkodowanej. Poza obrażeniami pierwotny-

PRACE ORYGINALNE

mi, jak złamania kości czaszki czy uszkodzenia tkanek głowy, występują również takie zmiany, jak krwiaki wewnątrzczaszkowe, padaczka lub inne objawy neurologiczne wynikające z ogniskowych uszkodzeń mózgu. Jednym z głównych skutków urazów czaszkowo-mózgowych jest zaburzenie sprawności motorycznej, objawiające się zmniejszeniem zakresu ruchów w stawach, patologicznym napięciem mięśniowym, trudnością w wykonywaniu ruchów precyzyjnych. U wielu pacjentów obserwuje się zaburzenia

Rozkład zaleconych zabiegów w rehabilitacji pacjentów po urazie czaszkowo-mózgowym …

lokomocji, które łączą się z zaburzeniami równowagi i nieprawidłowym cyklem chodu. Można często zaobserwować dysfunkcje neuropsychologiczne w postaci zaburzeń funkcji poznawczych, komunikacji, depresji, labilności emocjonalnej [2]. Przeprowadzone przez różnych autorów badania wskazują, że skutki urazów czaszkowo-mózgowych niosą za sobą szerokie spektrum zmian w życiu osoby poszkodowanej. Wskazane jest zatem, aby rehabilitacja, której poddawani są pacjenci po urazie czaszkowomózgowym, obejmowała kilka aspektów. Obok pierwszoplanowej rehabilitacji ruchowej również rehabilitację zawodową, psychoterapię oraz elementy integracji społecznej. Cel Celem pracy jest przeanalizowanie i przedstawienie programu rehabilitacji, stosowanego w OrtopedycznoRehabilitacyjnym Szpitalu Klinicznym im. W. Degi w Poznaniu u pacjentów po przebytym urazie czaszkowomózgowym. Materiał i metody Grupę badanych stanowią 54 osoby po przebytym urazie czaszkowo-mózgowym w wieku od 17 do 76 lat (średnia wieku 36,5) leczone w Ortopedyczno-Rehabilitacyjnym Szpitalu Klinicznym nr 4 im. Wiktora Degi w Poznaniu na Oddziale Rehabilitacyjnym IE w latach 2000–2011 r. W grupie badanych było 28 osób tylko z urazem czaszkowomózgowym i 26, które doznały także urazu wielonarządowego. Grupa ta obejmowała 21 kobiet i 33 mężczyzn. Wiek badanych w dniu urazu wynosił od 7 do 71 lat (średnia 27 lat i 10 miesięcy). Okres od urazu do momentu badania wynosił od 1 roku i 5 miesięcy do 38 lat (średnia 8 lat i 2 miesiące). Według skali nieprzytomności Glasgow (Glasgow Coma Scale – GCS) wśród badanych nie było osób z lekkim urazem mózgu, 37 osób doznało urazu średniego, natomiast u 17 osób uraz został oceniony jako ciężki. Badania polegały na analizie dokumentacji medycznej pacjentów oraz na analizie raportów stosowanych zabiegów rehabilitacyjnych w okresie leczenia w ORSK nr 4 im. W. Degi w Poznaniu. Skala GCS jest najpopularniejszą skalą wykorzystywaną do oceny stopnia świadomości osób po urazach czaszkowo-mózgowych. W skali tej reakcja osoby po urazie oceniana jest w trzech kategoriach – reakcja otwierania oczu, reakcja słowna i ruchowa [2]. Suma punktów wszystkich badanych parametrów określa stopień ciężkości urazu. Im mniejsza wartość odnotowanych punktów, tym uraz jest cięższy oraz rokowania dla pacjenta gorsze. Wynik skali waha się pomiędzy 3 punktami (śmierć), a 15 (pełen kontakt słowny i ruchowy). Stan nieprzytomności pacjenta określany jest w momencie, gdy punktacja GCS wynosi < 8 punktów. Głębokość urazu czaszkowo-mózgowego oceniana w skali GCS przedstawiona jest tabeli 1 [3].

289

Tabela 1. Poziom urazu wg skali GCS Table 1. Level of trauma according to GCS Poziom urazu lekki średni ciężki

Liczba punktów ≥ 13 9–12 ≤8

Wyniki

Charakterystyka zabiegów zastosowanych w rehabilitacji pacjentów należących do grupy badanej Podczas leczenia w Ortopedyczno-Rehabilitacyjnym Szpitalu Klinicznym im. W. Degi w Poznaniu pacjenci należący do grupy badanej najczęściej poddawani byli zabiegom z zakresu kinezyterapii. Były to ćwiczenia wzmacniające siłę mięśni, ćwiczenia ogólnousprawniające, ćwiczenia pełnego zakresu ruchów w stawach, ćwiczenia lokomocji oraz zabiegi zmniejszające spastyczne napięcie mięśni. W zależności od stanu funkcjonalnego pacjenta stosowano również zabiegi stymulujące mięśnie niedowładne, zabiegi fizykalne o działaniu przeciwbólowym, ćwiczenia oddechowe, ćwiczenia precyzyjne rąk. Kategorie zabiegów i ćwiczeń usprawniających, zastosowane u pacjentów należących do grupy badanej, w ujęciu rodzajowym i ilościowym przedstawia wykres 1.

Wykres 1. Zabiegi zastosowane u osób należących do grupy badanej (% osób należących do grupy badanej ogółem poddany poszczególnym zabiegom). Figure 1. Procedures applied in the control group (% of people belonging to the control group treated with a specific procedure).

U większości pacjentów po przebytym urazie czaszkowo-mózgowym zaordynowane zostały zabiegi z kategorii inne (ponad 50%). Ćwiczenia kinezyterapeutyczne stanowiły 32,8%, a usprawniające lokomocję 20,71%. Z dokumentacji medycznej wynika, że najmniejszej liczbie pacjentów zalecono zabiegi przeciwbólowe.

Ćwiczenia kinezyterapeutyczne Do ćwiczeń kinezyterapeutycznych, stosowanych podczas rehabilitacji ruchowej pacjentów po urazie czaszkowomózgowym, należały: ćwiczenia wzmacniające siłę mięśni, ogólnousprawniające, bloczkowe, pełnego zakresu ruchów w stawach kończyn. U pacjentów z dobrym kontaktem

PRACE ORYGINALNE

290

Katarzyna Kaźmierczak i inni

psychicznym zalecono ćwiczenia w wodzie. Procentowy rozkład zaleconych zabiegów podczas pobytu pacjentów na oddziale rehabilitacji przedstawia tabela 2. Tabela 2. Ćwiczenia kinezyterapeutyczne Table 2. Kinesiotherapic exercises Nazwa ćwiczenia ćw. ogólnousprawniające ćw. bloczkowe ćw. wzmacniające siłę mięśni kończyn ćw. czynne ćw. pełnego zakresu ruchów w stawach ćw. w wodzie ćw. gimnastyki porannej

Liczba osób 29 26 24 13 13 11 8

Z tabeli wynika, że są różnice w zaleceniach lekarskich dotyczących ćwiczeń kinezyterapeutycznych, w zależności od stopnia urazu czaszkowo-mózgowego ocenianego wg GCS, co prezentuje rycina 2.

Wykres 2. Ćwiczenia kinezyterapeutyczne przedstawione w zależności od stopnia urazu pacjenta wg GCS (odpowiednio % należących do grupy badanej osób po urazie średnim oraz % osób należących do grupy badanej po urazie ciężkim). Figure 2. Kinesiotherapic exercises presented due to the level of the trauma according to GCS (respectively, % of people belonging to the control group of people after moderate and % of people belonging to the control group of people after severe trauma).

Istotne różnice zauważalne są w ćwiczeniach czynnych, które zostały zalecone prawie trzykrotnie większej liczbie pacjentów, którzy doznali średniego urazu czaszkowo-mózgowego. Sytuację odwrotną, gdzie częściej poddawani zabiegom byli pacjenci po urazie ciężkim, zaobserwowano w przypadku ćwiczeń pełnego zakresu ruchów w stawach.

Ćwiczenia kształtujące lokomocję Do ćwiczeń kształtujących lokomocję, stosowanych podczas rehabilitacji ruchowej pacjentów po urazie czaszkowo-mózgowym, należały: ćwiczenia estetyki chodu, równoważne, prawidłowej postawy ciała, a także pionizacja i nauczanie obsługi oraz korzystania z wózka inwalidzkiego. Liczba osób, korzystających z tych zabiegów podczas okresu leczenia, została przedstawiona w tabeli 3.

PRACE ORYGINALNE

Tabela 3. Ćwiczenia kształtujące lokomocję Table 3. Locomotion exercises Nazwa ćwiczenia estetyki chodu równoważne pionizacja prawidłowej postawy korzystanie z wózka inwalidzkiego

Liczba osób 22 20 8 4 3

W grupie ćwiczeń kształtujących lokomocję najczęściej wykorzystywane były ćwiczenia estetyki chodu oraz ćwiczenia równoważne. Najrzadziej natomiast nauczano pacjentów korzystania z wózka inwalidzkiego. Procentowy rozkład ćwiczeń kształtujących lokomocję w zależności od stopnia urazu czaszkowo-mózgowego wg GCS ilustruje rycina 3.

Wykres 3. Ćwiczenia kształtujące lokomocję przedstawione w zależności od stopnia urazu pacjenta wg GCS (odpowiednio % należących do grupy badanej osób po urazie średnim i % osób należących do grupy badanej po urazie ciężkim). Figure 3. Locomotion exercises presented depending on the level of trauma according to GCS (respectively, % of people belonging to the control group of people after moderate and % of people belonging to the control group of people after severe trauma).

U ponad 43% pacjentów, którzy doznali średniego urazu czaszkowo-mózgowego wg skali GCS, zalecane były ćwiczenia równoważne oraz ćwiczenia estetyki chodu.

Zabiegi fizykoterapeutyczne przeciwbólowe Spośród zabiegów fizykoterapeutycznych o działaniu przeciwbólowym, w terapii pacjentów po urazie czaszkowo-mózgowym stosowane były zabiegi elektroterapeutyczne, takie jak prądy NC, TENS, diadynamic oraz laseroterapia. Procentowy rozkład zaleconych zabiegów fizykalnych podczas terapii w ORSK im. W. Degi w Poznaniu prezentuje tabela 4. Zależność stosowanego zabiegu od stopnia urazu przedstawiono na rycinie 4. Zaobserwowano również związek między rodzajem zastosowanego zabiegu a stopniem urazu. Jedynie pacjenci po średnim urazie wg GCS korzystali z zabiegu laseroterapii.

Rozkład zaleconych zabiegów w rehabilitacji pacjentów po urazie czaszkowo-mózgowym …

291

Tabela 4. Przeciwbólowe zabiegi fizykoterapeutyczne Table 4. Analgetic procedures Nazwa zabiegu prądy NC prądy TENS prądy diadynamic laseroterapia

% wszystkich zabiegów przeciwbólowych 3 1 1 1

Wykres 5. Zalecone zabiegi zmniejszające spastyczne napięcie mięśni w zależności od stopnia urazu pacjenta wg GCS (odpowiednio % należących do grupy badanej osób po urazie średnim i % osób należących do grupy badanej po urazie ciężkim). Figure 5. Recommended procedures directed to reduction of depending of muscle spasticity the level of trauma according to GCS (respectively, % of people belonging to the control group of people after moderate and % of people belonging to the control group of people after severe trauma). Wykres 4. Zalecony zabieg fizykoterapeutyczny przeciwbólowy w zależności od stopnia urazu pacjenta wg GCS (odpowiednio % należących do grupy badanej osób po urazie średnim i % osób należących do grupy badanej po urazie ciężkim). Figure 4. Recommended analgetic procedures depending on the level of trauma according to GCS (respectively, % of people belonging to the control group of people after moderate and % of people belonging to the control group of people after severe trauma).

Zabiegi zmniejszające spastyczne napięcie mięśni W usprawnianiu pacjentów badanej grupy leczonych w ORSK nr 4 im. W. Degi w Poznaniu stosowano zabiegi zmniejszające wzmożone napięcie mięśni. Z tej grupy zabiegów stosowano ćwiczenia rozluźniające, a z elektroterapii tonolizę. Liczbę osób, którym zalecono zabiegi przedstawia tabela 5. Różnice w stosowanych zabiegach przeciwdziałających spastycznemu napięciu mięśni stosowanych u pacjentów ze średnim i ciężkim urazem czaszkowo-mózgowym, ocenianym wg skali GCS widoczne są na rycinie 5. Tabela 5. Zabiegi zmniejszające spastyczne napięcie mięśni Table 5. Procedures directed to reduction of muscle spasticity Nazwa zabiegu okłady parafinowe ćwiczenia w wodzie ćwiczenia rozluźniające krioterapia fluidoterapia tonoliza lampa Sollux

Zabiegi stymulujące mięśnie niedowładne Zabiegami stymulującymi mięśnie niedowładne były głównie ćwiczenia reedukacji nerwowo-mięśniowej, ćwiczenia z wykorzystaniem metody Vojty oraz metody PNF, a także elektrostymulacja mięśni. Procentowy rozkład zaleconych zabiegów przedstawia tabela 6. Tabela 6. Zabiegi stymulujące mięśnie niedowładne Table 6. Procedures stimulating paretic muscles Nazwa zabiegu ćw. reedukacji nerwowo-mięśniowej ćw. metodą PNF ćw. metodą Vojty elektrostymulacja

Liczba osób 13 7 3 2

Zabiegom stymulującym obniżone napięcie mięśni poddawane były głownie osoby, u których uraz czaszkowo-mózgowy był ciężki wg skali GCS. Jedynie u tej grupy badanych (11,77%) stosowane były zabiegi elektrostymulacji mięśni.

Liczba osób 13 11 6 5 5 4 3

Zabiegi tonolizy i ćwiczenia rozluźniające częściej zalecane były osobom po ciężkim urazie czaszkowo-mózgowym – 17,65% badanych osób. Rozkład pozostałych zabiegów obniżających spastyczne napięcie mięśni jest podobny w porównywanych grupach.

Wykres 6. Zalecone zabiegi stymulujące mięśnie niedowładne przedstawione w zależności od stopnia urazu pacjenta wg GCS (odpowiednio % należących do grupy badanej osób po urazie średnim i % osób należących do grupy badanej po urazie ciężkim). Figure 6. Recommended procedures stimulating paretic muscles presented depending on the level of trauma according to

PRACE ORYGINALNE

292

Katarzyna Kaźmierczak i inni

GCS (respectively, % of people belonging to the control group of people after moderate and % of people belonging to the control group of people after severe trauma).

Spośród zaleconych ćwiczeń stymulujących mięśnie osłabione wyraźną różnicę można zaobserwować w rozkładzie procentowym zaordynowanych ćwiczeń reedukacji nerwowo-mięśniowej oraz ćwiczeń metodą PNF w zależności od stopnia doznanego urazu czaszkowo-mózgowego ocenianego wg skali GCS a także w zabiegach elektrostymulacji mięśniowej, co ukazuje rycina 6.

Inne zabiegi terapeutyczne zalecane w rehabilitacji osób po urazie czaszkowo-mózgowym Do innych ćwiczeń stosowanych w programie rehabilitacji badanych osób stosowano ćwiczenia w ramach terapii zajęciowej, ćwiczenia logopedyczne, ćwiczenia oddechowe i ruchów precyzyjnych rąk. Liczbę osób i procentowy rozkład wymienionych zabiegów prezentuje kolejno tabela 7 i rycina 7. Tabela 7. Inne zabiegi terapeutyczne zalecane w rehabilitacji osób po urazie czaszkowo-mózgowym Table 7. Other procedures recommended in rehabilitation of people after TBI Nazwa zabiegu ćwiczenia oddechowe terapia zajęciowa logopedia ćw. precyzyjne rąk

Liczba osób 36 33 30 10

Wykres 7. Inne zalecone zabiegi rehabilitacyjne przedstawione w zależności od stopnia urazu pacjenta wg GCS (odpowiednio % należących do grupy badanej osób po urazie średnim i % osób należących do grupy badanej po urazie ciężkim). Figure 7. Other procedures presented depending on the level of trauma according to GCS (respectively, % of people belonging to the control group of people after moderate and % of people belonging to the control group of people after severe trauma).

Nie zaobserwowano większych różnic dotyczących zaleconych zabiegów w porównaniu z innymi zabiegami terapeutycznymi stosowanymi w usprawnianiu pacjentów po urazie czaszkowo-mózgowym przy uwzględnieniu stopnia urazu wg skali GCS.

PRACE ORYGINALNE

Dyskusja Rehabilitacja osób po urazie czaszkowo-mózgowym według koncepcji Degi powinna być wczesna i kompleksowa [4]. Wymagana jest współpraca różnych specjalistów, jak i bliski kontakt chorego z rodziną i przyjaciółmi. Głównym celem usprawniania jest uzyskanie maksymalnej poprawy funkcjonalnej pacjenta w wykonywaniu czynności życia codziennego, a także zmniejszenie dolegliwości bólowych i uzyskanie poprawy zaburzonych funkcji poznawczych [5, 6]. Głównymi składowymi terapii podczas pobytu pacjenta na oddziale rehabilitacyjnym powinny być działania ukierunkowane na usprawnianie motoryczne osoby po urazie czaszkowo-mózgowym. Szczególnie ważne jest przeciwdziałanie patologicznemu napięciu mięśniowemu i zmniejszenie ograniczeń funkcjonalnych [7]. Z analizy dokumentacji medycznej osób należących do grupy badanych wynika, że w rehabilitacji pacjentów leczonych w ORSK nr 4 im. W. Degi w Poznaniu stosowano szeroką gamę zabiegów fizjoterapeutycznych z wykorzystaniem relatywnie nowoczesnych metod. Z danych piśmiennictwa wynika, że wzmożone napięcie mięśni leczone jest głównie farmakologicznie, z użyciem takich leków doustnych, jak: baklofen, diazepam czy klonidyna lub podawana jest domięśniowo lub dożylnie toksyna botulinowa. Istnieją jednak również inne sposoby stosowane w terapii spastyczności. Są to zabiegi cieplne, zimno, ultradźwięki, stymulacja elektryczna oraz biofeedback EMG [8]. Liczne badania wskazują na powszechne stosowanie termoterapii w leczeniu spastyczności [9, 10], lecz stosowana jest także krioterapia [9, 11, 12]. Zastosowanie ćwiczeń w wodzie w leczeniu wzmożonego napięcia mięśniowego jest wielowymiarowym działaniem. Ciepła woda używana jest do podniesienia temperatury tkanek, zmniejszenia ich napięcia oraz zniesienia odczuwania bólu. Wpływa również korzystnie na psychikę pacjenta, a delikatny masaż wibracyjny wpływa na komfortowe samopoczucie i rozluźnienie. Hydroterapię stosuje się jako zabieg poprzedzający ćwiczenia poprawiające wytrzymałość mięśni lub zwiększające zakres ruchów w stawach [8, 13, 14]. W ramach elektroterapii stosuje się zabiegi zmniejszające ból. Stosuje się stymulację pobudzającą osłabiony mięsień lub przeciwbólową (TENS) [15, 16, 17]. Podczas leczenia analizowanej grupy chorych w ORSK nr 4 im. W. Degi w Poznaniu, stosowano indywidualny program usprawniania ustalony w oparciu o wyniki badań przedmiotowych i podmiotowych. Szczególnie ważna jest ocena funkcjonalna i ustalenie zdolności do wykonywania czynności życia codziennego takich jak jedzenie, ubieranie się czy zabiegi higieniczne, angażujące odpowiednie ruchy kończyn górnych [18, 19]. Celem poprawy lokomocji jest uzyskanie sprawności kończyn dolnych poprzez ćwiczenia wzmacniające siłę mięśniową, ćwiczenia równoważne i ćwiczenia prawidłowej postawy ciała [20].

Rozkład zaleconych zabiegów w rehabilitacji pacjentów po urazie czaszkowo-mózgowym …

Programy rehabilitacji prowadzone w ORSK nr 4 im. W. Degi w Poznaniu skupiały się na fachowym usprawnieniu fizycznym i zmniejszeniu u pacjenta istniejących wcześniej dolegliwości bólowych. Pacjenci po urazie czaszkowo-mózgowym korzystali również w procesie usprawniania w ORSK im. W. Degi w Poznaniu z programu terapii zajęciowej, ćwiczeń logopedycznych, a także spotkań z psychologiem, których celem jest poprawa zdolności komunikacji. Jednak u pacjentów po urazach czaszkowo-mózgowych spośród zaburzeń o charakterze neuropsychologicznym nierzadko spotyka się spowolnienie myślenia i kojarzenia, zaburzenia uwagi i koncentracji, a także niepokój, izolację, depresję czy wahania nastrojów [21–25]. Zmiany te wpływają niewątpliwie na szybkość i efekty procesu usprawniania oraz ogólny komfort i jakość życia pacjenta. Stąd nie tylko usprawnianie fizyczne, lecz również profesjonalna terapia psychologiczna wydaje się być istotnym elementem w kompleksowej rehabilitacji osoby po urazie czaszkowo-mózgowym. Wnioski 1. Leczenie usprawniające stosowane w ORSK nr 4 im. W. Degi w Poznaniu u osób po urazie czaszkowomózgowym było ukierunkowane na uzyskanie poprawy funkcjonalnej i zmniejszenie występujących dysfunkcji ruchowych. 2. Ćwiczenia równoważne oraz ćwiczenia poprawiające estetykę chodu częściej stosowano u osób po średnim urazie wg GCS. 3. U pacjentów po ciężkim urazie czaszkowo-mózgowym wykonywane były zabiegi elektroterapeutyczne o działaniu przeciwbólowym. 4. Ćwiczenia w terapii zajęciowej i logopedyczne stosowano u większości analizowanych osób w zależności od wskazań terapeutycznych. Piśmiennictwo 1. Wojtyniak B., Stokwiszewski J., Goryński P i wsp.: Długość życia i umieralność ludności Polski. Sytuacja Zdrowotna Ludności Polski. Red: Wojtyniak B., Goryński P., Narodowy Instytut Zdrowia Publicznego – Państwowy Zakład Higieny. Warszawa 2008, 40-47. 2. Pąchalska M.: Uraz mózgu w praktyce klinicznej neuropsychologa. Neuropsychologia kliniczna. Urazy mózgu. Tom I, Wydawnictwo Naukowe PWN Warszawa 2007, 77111. 3. Silver J.M., McAllister T.W., Yodofsky S.C., eds.: Textbook of Traumatic Brain Injury. Am. Psych. Publ., 2005, 27-39. 4. Sirois M.J., Lavoie A., Dionne C.E.: Impact of transfer delays to rehabilitation in patients with severe traumatic brain injury. Arch. Psych. Med. Rehabil., 2004, 85, 184-191. 5. Khan F., Baugley I.J., D Cameron I.: MJA Practice Essentials, 4: Rehabilitation after traumatic brain injury. MJA, 2003, 290-295. 6. Winkler D, Unsworth C, Sloan S.: Factors that lead to successful 6. community integration following severe traumatic brain injury. J. Head Trauma Rehabil., 2006, 21, 8-21.

293

7. Forsyth R.: Rehabilitation after brain injuries. Current Pediatrics, 2002, 12, 275-278. 8. Kesiktas N., Paker N., Erdogan N. i wsp.: The use of hydrotherapy for the management of spasticity. Neurorehabil. Neural. Repair., 2004 Dec, 18(4), 268-73. 9. Gracies J.M.: Physical modalities other than stretch in spastic hypertonia. Phys. Med. Rehabil. Clin. N. Am., 2001 Nov, 12(4), 769-92. 10. Matsumoto S., Kawahira K., Etoh S. i wsp.: Short-term effects of thermotherapy for spasticity on tibial nerve F-waves in post-stroke patients. Int. J. Biometeorol., 2006 Mar, 50(4), 243-50. 11. Annaswamy T., Mallempati S., Allison S.C. i wsp.: Measurement of plantarflexor spasticity in traumatic brain injury: correlational study of resistance torque compared with the modified Ashworth scale. Am. J. Phys. Med. Rehabil., 2007 May, 86(5), 404-11. 12. Allison S.C., Abraham L.D.: Sensitivity of qualitative and quantitative spasticity measures to clinical treatment with cryotherapy. Int. J. Rehabil., Res. 2001 Mar, 24(1), 15-24. 13. Koury J.M.: Benefits of an aquatic therapy program. Koury J.M. ed. Aquatic therapy programming. Champaign. Human Kinetics. 1996, 1-11. 14. Gass E.M., Gass G.C., Pitetti K.: Thermoregulatory responses to exercise and warm water immersion in physically trained men with tetraplegia. Spinal Cord, 2002, 40, 474-80. 15. Kara B., Baskurt F., Acar S., Karadibak D. i wsp.: The effect of TENS on pain, function, depression, and analgesic consumption in the early postoperative period with spinal surgery patients. Turk. Neurosurg., 2011, 21(4), 618-24. 16. Ratajczak B., Hawrylak A., Demidaś A. i wsp.: Effectiveness of diadynamic currents and transcutaneous electrical nerve stimulation in disc disease lumbar part of spine. J. Back Musculoskelet Rehabil., 2011, 24(3), 155-9. 17. Schuhfried O., Crevenna R., Fialka-Moser V. i wsp.: Noninvasive neuromuscular electrical stimulation in patients with central nervous system lesions: An educational review. J. Rehabil. Med., 2012 Feb, 44(2), 99-105. 18. Frisch S., Förstl S., Legler A. i wsp.: The interleaving of actions in everyday life multitasking demands. J. Neuropsychol., 2012 Feb 13., doi: 10.1111/j.1748-6653.2012.02026.x. [Epub ahead of print] 19. Shaw S.E., Morris D.M., Uswatte G. i wsp.: Constraintinduced movement therapy for recovery of upper-limb function following traumatic brain injury. J. Rehabil. Res. Dev., 2005 Nov-Dec, 42(6), 769-78. 20. Williams G., Clark R., Schache A. i wsp.: Training conditions influence walking kinematics and self-selected walking speed in patients with neurological impairments. J. Neurotrauma, 2011 Feb, 28(2), 281-7. 21. Miotto E.C., Cinalli F.Z., Serrao V.T. i wsp.: Cognitive deficits in patients with mild to moderate traumatic brain injury. Arquivos de neuropsiquiatria, 2010, 68, 6, 675-692. 22. Saunders J.C., McDonald S., Richardson R.: Loss of emotional experience after traumatic brain injury findings with the startle probe procedure. Neuropsychology, 2006, 20, 224-231. 23. Mathias J., Wheaton P.: Changes in attention and information-processing speed following severe traumatic brain injury. Neuropsychology, 2007, 21, 212-223.

PRACE ORYGINALNE

294

Katarzyna Kaźmierczak i inni

24. Ziino C., Ponsford J.: Selective attention deficits and subjective fatigue following traumatic brain injury. Neuropsychology, 2006, 20, 383-390. 25. Rapoport M.J.: Depression following traumatic brain injury: epidemiology, risk factors and management. CNS Drugs,. 2012 Feb 1, 26(2), 111-21.

PRACE ORYGINALNE

Adres do korespondencji: Katarzyna Kaźmierczak Katedra i Klinika Rehabilitacji UMP ul. 28 Czerwca 1956 r. 61-545 Poznań [email protected]

Nowiny Lekarskie 2011, 80, 4, 295–298

ALEKSANDRA BRUŚ-CHOJNICKA1, ANDRZEJ MARSZAŁEK2, MAGDALENA MOSKALIK3, ARLETA KOWALA-PIASKOWSKA4, IWONA MOZER-LISEWSKA2,4

PROBLEMY ZWIĄZANE Z ZAKAŻENIEM WIRUSEM HBV W KONTEKŚCIE PROKREACJI I ŻYCIA SEKSUALNEGO KOBIET THE ISSUE OF HBV INFECTED WOMEN ASSOCIATED WITH PROCREATION AND SEXUAL LIFE 1

Oddział Położniczo-Ginekologiczny Szpital Wojewódzki w Poznaniu Kierownik: lek. Andrzej Polaszewski 2 Oddział Zakaźny Wielospecjalistyczny Szpital Miejski im. J. Strusia w Poznaniu Kierownik: prof. dr hab. n. med. Iwona Mozer-Lisewska 3 Oddział Neurologii Szpital Wojewódzki w Poznaniu Kierownik: lek. Adam Ziółkiewicz 4 Katedra i Klinika Chorób Zakaźnych Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Kierownik: prof. dr hab. n. med. Iwona Mozer-Lisewska

Streszczenie Autorzy przybliżają problem przewlekłego zakażenia wirusem HBV u kobiet w okresie planowania ciąży, ciąży oraz porodu. Wirus zapalenia wątroby typu B cechuje się dużą zakaźnością. Pomimo obecności skutecznej i bezpiecznej szczepionki jest nadal istotnym problemem w Polsce. W artykule zawarto nowe strategie postępowania z pacjentkami będącymi nosicielkami HBV, oparte na publikacjach z ostatnich lat. KEY WORDS: zapalenie wątroby, życie seksualne, ciąża, HBV.

Summary The authors analyse chronic HBV infection in subpopulations of women planning pregnancy, pregnant and those in labour. Despite the availability of effective and safe HBV vaccine, HBV infections are still a major health issue in Poland. The article outlines new strategies of providing adequate healthcare for HBV infected women based on the most recent published data. KEY WORDS: hepatitis, sexual life, pregnancy, HBV.

Wstęp Wirusowe zapalenie wątroby typu B należy do głównych zagrożeń zdrowotnych populacji świata [1]. Ocenia się, że co trzeci mieszkaniec ziemi został zarażony wirusem HBV, z czego u 300 milionów osób infekcja przeszła w fazę przewlekłą. Dzięki obecności skutecznej szczepionki, rutynowo stosowanej w wielu krajach, nastąpiła znaczna poprawa kontroli infekcji. Sytuacja epidemiologiczna oraz dominujące drogi zakażenia różnią się w zależności od statusu ekonomicznego kraju. W krajach rozwijających się znacznie częściej dochodzi do transmisji drogą wertykalną oraz do jatrogennego zakażenia pacjenta, podczas gdy w krajach rozwiniętych większe znaczenie ma droga wenerologiczna oraz przekazanie wirusa u osób przyjmujących dożylnie narkotyki. Szczegółowe dane dla Polski, publikowane w Dziennikach Epidemiologicznych przez Państwowy Zakład Higieny, mówią o wykryciu w 2011 roku 1583 nowych zakażeń tym wirusem, z czego aż ponad 85% stanowiło przewlekłe Wirusowe Zapalenie Wątroby typu B (WZW B). Dokładna liczba nosicieli wirusa HBV w Polsce nie

jest znana, ale przyjmuje się, że nie przekracza 1,5% populacji [2]. Sytuacja epidemiologiczna w Polsce, od wprowadzenia szczepionki przeciw WZW B do kalendarza szczepień, uległa poprawie i obecnie profil zachorowań przypomina sytuację w społeczeństwach Europy Zachodniej [3]. Analizując rozkład nowych zachorowań, obserwuje się dwa szczyty. Pierwszy występuje wśród nastolatków i młodych dorosłych, najprawdopodobniej wynikający z aktywności seksualnej, i drugi wśród osób w szóstej i siódmej dekadzie życia, związany z narażeniem na czynniki jatrogenne [3]. WZW B jako choroba wenerologiczna Wirus HBV obecny jest we krwi, wydzielinie pochwowej oraz w nasieniu [4]. Dokładne oznaczenie częstości zakażeń drogą seksualną jest trudne z powodu niemożności wydzielenia ryzyka związanego z mieszkaniem z osobą zainfekowaną [4]. Wielokrotnie potwierdzono dużą rolę transmisji seksualnej w epidemiologii WZW B, znacznie większą niż w przypadku WZW C oraz HIV. Analogicznie jak w innych chorobach wenerycznych o etiologii wirusowej, antykoncepcja mecha-

PRACE POGLĄDOWE

296

Aleksandra Bruś-Chojnicka i inni

niczna znacząco zmniejsza ryzyko zakażenia partnera. Dla ograniczenia zakaźności duże znaczenie epidemiologiczne mają również rutynowe szczepienia osób współmieszkających z chorą osobą, a zwłaszcza ich partnerów seksualnych, prowadzone przez Państwową Inspekcję Sanitarną. Ciąża a zakażenie HBV Przewlekłe WZW B u mężczyzny zmniejsza szansę posiadania potomstwa [5]. Infekcja HBV, podobnie jak HCV oraz przeciwnie niż HIV, zmniejsza żywotność, ruchliwość oraz ilość plemników w ejakulacie [5]. W ostatnich latach miała miejsce dyskusja na temat bezpieczeństwa dokonywania zapłodnienia in vitro od dawców będących nosicielami HBs, jednak opracowanie specjalnej metody płukania nasienia zminimalizowało ryzyko takiego zakażenia [6]. W przypadku stosowania metod wspomaganego rozrodu u kobiety będącej nosicielem HBV, ryzyko transmisji wertykalnej nie różni się od ryzyka w całej populacji kobiet ciężarnych z WZW B. Pomimo braku badań dopuszcza się stosowanie szczepionki przeciw WZW typu B w okresie ciąży oraz karmienia piersią. Szczepionki nie zawierają wirionów HBV, dlatego nawet u osób o obniżonej odporności nie ma możliwości rozwoju zakażenia [7]. Amerykański program eradykacji HBV przewiduje szczepienia anty-HBV u kobiet ciężarnych z grup ryzyka, tj. mających kontakty seksualne z więcej niż jednym partnerem w ciągu ostatnich 6 miesięcy przed ciążą lub posiadających partnera z antygenemią HBs. Badanie obecności antygenu HBs, świadczącego o aktywnym zakażeniu, jest testem zalecanym przez polskiego ustawodawcę do wykonania między 33 a 37 tygodniem ciąży [8]. Wynik dodatni umożliwi wprowadzenie immunizacji bierno-czynnej, która charakteryzuje się znacząco większą skutecznością od zastosowania samego szczepienia w pierwszej dobie życia [9]. Dotychczasowe badania przesiewowe wśród kobiet ciężarnych, w tym dwa największe przeprowadzone w USA oraz Danii, pokazują, że ich zastosowanie pozwala zwiększyć wykrywalność zakażeń o ok. 50% w danej grupie wiekowej [10, 11]. Ryzyko transmisji wertykalnej przy braku zastosowania profilaktyki zależy od etapu infekcji mającego swoje wykładniki w statusie serologicznym. Przy obecności jedynie HbsAg we krwi ciężarnej, ryzyko to sięga 15% i może rosnąć aż do 90% przy obecności HBV-DNA lub antygenu HBe, zaś jego wartość zależy wprost proporcjonalnie od liczby kopii wirusa we krwi [9]. Duże chińskie badanie z 2007 roku pokazało, że częstość kontaktów seksualnych w drugim trymestrze ciąży na równi z obecnością HBV-DNA są jedynymi niezależnymi czynnikami ryzyka transmisji [12]. Mimo licznych badań nad wpływem infekcji HBV na kobietę ciężarną nadal brakuje jednoznacznych danych. Leo wraz z zespołem opublikował w 2007 roku analizę czynników wikłających przebieg ciąży u blisko 14 000 kobiet [13]. W przedstawionym badaniu zakażenie HBV, podobnie

PRACE POGLĄDOWE

jak HCV, było niezależnym czynnikiem zwiększającym ryzyko cukrzycy ciążowej. Dzięki analizie dużej liczby powikłanych ciąż autorzy określili, że ryzyko wystąpienia cukrzycy wzrasta o 20%. Ten sam zespół badaczy we wcześniejszej publikacji wykazał wpływ antygenu HBs na podwyższony poziom żelaza oraz ferrytyny, co wtórnie powodowało podwyższenie glikemii w trzecim trymestrze ciąży [14]. W prezentowanym badaniu, mimo zwiększonego ryzyka wystąpienia cukrzycy ciężarnych, przewlekła infekcja HBV pozostawała bez wpływu na rozwój płodu oraz późniejszy poród. Innym badaniem, opublikowanym w 2005 roku, jest wsteczna analiza przebiegu ciąż oraz porodów u 253 ciężarnych, będących nosicielkami HBV, w porównaniu z grupą kontrolną dobraną względem wieku oraz roku porodu [15]. Spośród analizowanych 20 powikłań położniczych znamienność statystyczną otrzymano w przypadku częstszego wystąpienia cukrzycy ciężarnych, krwotoków poporodowych oraz porodów przedwczesnych < 34 tygodnia ciąży. Nie wykazano znamienności statystycznych wśród porodów < 32 i < 37 tygodnia ciąży [15]. Leczenie przeciwwirusowe w ciąży Nie potwierdzono, aby użycie leków przeciwwirusowych stosowanych w leczeniu WZW B miało teratogenne działanie na płód. Lamiwudyna, adefovir oraz entecavir posiadają kategorię C, czyli mimo dużego doświadczenia z użyciem tych leków u kobiet z infekcją HIV będących w ciąży, nadal brakuje badań potwierdzających ich bezpieczeństwo wśród zarażonych HBV. Lekiem o najlepiej udokumentowanym profilu bezpieczeństwa w ciąży jest tenofowir, posiadający kategorię B [16]. Połóg Pomimo że okres ciąży jest stanem łagodnej immunosupresji, opisano przypadki piorunującego zapalenia wątroby, wymagającego przeszczepu u młodych kobiet, u których nie stwierdzono wcześniej infekcji [17]. W opisywanych przypadkach pełna diagnoza została postawiona dopiero po wystąpieniu żółtaczki oraz encefalopatii wątrobowej. Autorzy zwracają uwagę na zasadność regularnego kontrolowania aminotransferaz podczas ciąży u kobiet z przewlekłym WZW B. Znacznie częściej obserwuje się izolowany wzrost aminotransferazy alaninowej, występujący w ciągu 6 miesięcy po porodzie [18]. W badanej populacji kobiet z obecnym antygenem HbS wzrost trzykrotny odnotowano u 45–65%, w zależności od wielkości wiremii, w ciąży, zaś nawet czterokrotny wzrost w tym czasie nie łączył się z dekompensacją funkcji wątroby [18]. Opisano również piorunujące zapalenia wątroby występujące bezpośrednio po porodzie [18–20]. Najczęstszym objawem rozwijającego się zapalenia jest zespół wewnątrznaczyniowej koagulopatii, uniemożliwiający wykonanie przeszczepu wątroby [21]. Sposobem na uniknięcie tego ciężkiego powikłania wg chińskich autorów jest skrócenie czasu porodu, a zwłaszcza III okresu [21].

Problemy związane z zakażeniem wirusem HBV w kontekście prokreacji i życia seksualnego kobiet

Karmienie piersią Pomimo obecności wirusa w mleku matki, nie udowodniono, aby karmienie piersią było dodatkowym czynnikiem ryzyka transmisji wertykalnej HBV [22]. Konsensus w tej sprawie został ustalony w 1998 przez Światową Organizację Zdrowia [1]. Zaleca on karmienie piersią w każdym przypadku, również przy braku możliwości zastosowania immunoterapii biernej oraz szczepień. Udowodniono również, że u dzieci zaszczepionych w pierwszej dobie aktywna replikacja wirusa w krwi matki nie wpływa na skuteczność immunizacji [9]. Noworodek Ocenia się, że zastosowanie profilaktyki biernoczynnej u noworodków matek z wiremią HBV jest nieskuteczne w około 10% [9]. Infekcja wertykalna jest szczególnie niebezpieczna, gdyż w przeciwieństwie do infekcji HBV dorosłych znacznie większy odsetek zakażeń przechodzi w stan przewlekły [9]. Inną formą profilaktyki, niedostępną w Polsce z powodu braku rejestracji lamiwudyny w leczeniu kobiet ciężarnych, jest użycie tego leku w ostatnich tygodniach ciąży u kobiet z wysoką wiremią. W 2011 roku opublikowano dużą metaanalizę potwierdzającą dużą skuteczność takiego działania [23]. Oceniono, że podanie lamiwudyny u kobiet od 28 tygodnia ciąży z wiremią HBV poniżej 106 kopii/ml jest skuteczniejsze od podania szczepionki oraz przeciwciał noworodkowi. Udowodniono również, że takie postępowanie jest bezpieczne zarówno dla płodu, jak i matki [23]. Przy wysokiej wiremii, powyżej 108 kopii/ml, użycie lamiwudyny jako jedynego środka profilaktyki nie jest skuteczne [23]. W trakcie pisania tego artykułu prowadzona jest rekrutacja do badania klinicznego oceniającego skuteczność tenofoviru u kobiet w ciąży z wysoką wiremią z jednoczasowym zastosowaniem profilaktyki bierno-czynnej u noworodka [24]. Podsumowanie W ostatnich latach pojawiło się kilka dużych metaanaliz dotyczących wertykalnej drogi infekcji HBV. Jednocześnie nadal prowadzone są badania kliniczne nad stosowaniem nowych leków u kobiet w ciąży. Pojawianie się nowych faktów sprawia, że dotychczasowe standardy opieki nad kobietą ciężarną wymagają ciągłego uaktualniania. Piśmiennictwo 1. WHO: Hepatitis B and breastfeeding. J. Int. Assoc. Physicians AIDS Care, 1998, 4, 20-1. 2. Lavanchy D.: Hepatitis B virus epidemiology, disease burden, treatment, and current and emerging prevention and control measures. J. Viral. Hepat., 2004, 11, 97-107. 3. Państwowy Zakład Higieny. Meldunki Epidemiologiczne, 2012, www.pzh.gov.pl. 4. Ayoola E.A., Odelola H.A., Ladipo O.A.: Hepatitis B surface antigen in menstrual blood and semen. Int. J. Gynaecol. Obstet., 1980, 18, 185-7.

297

5. Lorusso F., Palmisano M., Chironna M., Vacca M. i wsp.: Impact of chronic viral diseases on semen parameters. Andrologia, 2010, 42, 121-6. 6. Englert Y., Lesage B., Van Vooren J.P., Liesnard C. i wsp.: Medically assisted reproduction in the presence of chronic viral diseases. Hum. Reprod. Update, 2004, 10, 149-62. 7. Mast E.E., Weinbaum C.M., Fiore A.E., Alter M.J. i wsp.: A comprehensive immunization strategy to eliminate transmission of hepatitis B virus infection in the United States: recommendations of the Advisory Committee on Immunization Practices (ACIP) Part II: immunization of adults. MMWR Recomm. Rep., 2006, 55, 1-33; quiz CE1-4. 8. Dziennik Ustaw nr 147. 2011. 9. Lee C., Gong Y., Brok J., Boxall E.H. i wsp.: Effect of hepatitis B immunisation in newborn infants of mothers positive for hepatitis B surface antigen: systematic review and meta-analysis. BMJ, 2006, 332, 328-36. 10. Jonas M.M., Schiff E.R., O'Sullivan M.J., de Medina M. i wsp.: Failure of Centers for Disease Control criteria to identify hepatitis B infection in a large municipal obstetrical population. Ann. Intern. Med., 1987, 107, 335-7. 11. Harder K.M., Cowan S., Eriksen M.B., Krarup H.B. i wsp.: Universal screening for hepatitis B among pregnant women led to 96% vaccination coverage among newborns of HBsAg positive mothers in Denmark. Vaccine, 2011, 29, 9303-7. 12. Shao Z.J., Xu D.Z., Xu J.Q., Li J.H. i wsp.: Maternal hepatitis B virus (HBV) DNA positivity and sexual intercourse are associated with HBV intrauterine transmission in China: a prospective case-control study. J. Gastroenterol. Hepatol., 2007, 22, 165-70. 13. Lao T.T., Chan B.C., Leung W.C., Ho L.F. i wsp.: Maternal hepatitis B infection and gestational diabetes mellitus. J. Hepatol., 2007, 47, 46-50. 14. Lao T.T., Chan P.L.,Tam K.F.: Gestational diabetes mellitus in the last trimester – a feature of maternal iron excess? Diabet. Med., 2001, 18, 218-23. 15. Tse K.Y., Ho L.F.,Lao T.: The impact of maternal HBsAg carrier status on pregnancy outcomes: a case-control study. J. Hepatol., 2005, 43, 771-5. 16. Pan C.Q., Mi L.J., Bunchorntavakul C., Karsdon J. i wsp.: Tenofovir Disoproxil Fumarate for Prevention of Vertical Transmission of Hepatitis B Virus Infection by Highly Viremic Pregnant Women: A Case Series. Dig. Dis. Sci., 2012. 17. Singhal A., Kanagala R., Jalil S., Wright H.I. i wsp.: Chronic HBV with pregnancy: reactivation flare causing fulminant hepatic failure. Ann. Hepatol., 2011, 10, 233-6. 18. Borg M.J., Leemans W.F., de Man R.A.,Janssen H.L.: Exacerbation of chronic hepatitis B infection after delivery. J. Viral. Hepat., 2008, 15, 37-41. 19. Yang Y.B., Li X.M., Shi Z.J., Ma L.: Pregnant woman with fulminant hepatic failure caused by hepatitis B virus infection: a case report. World J. Gastroenterol., 2004, 10, 2305-6. 20. Tank P.D., Nadanwar Y.S.,Mayadeo N.M.: Outcome of pregnancy with severe liver disease. Int. J. Gynaecol. Obstet., 2002, 76, 27-31. 21. Xu H.: Analysis of 18 cases of postpartum haemorrhagic shock in pregnancy with virus hepatitis. Zhonghua Fu Chan Ke Za Zhi, 1992, 27, 150-2, 188-9. 22. Zheng Y., Lu Y., Ye Q., Xia Y. i wsp.: Should chronic hepatitis B mothers breastfeed? a meta analysis. BMC Public Health, 11, 502.

PRACE POGLĄDOWE

298

Aleksandra Bruś-Chojnicka i inni

23. Han L., Zhang H.W., Xie J.X., Zhang Q. i wsp.: A metaanalysis of lamivudine for interruption of mother-to-child transmission of hepatitis B virus. World J. Gastroenterol., 2011, 17, 4321-33. 24. LLC N.D.: Tenofovir in Late Pregnancy to Prevent Vertical Transmission of Hepatitis B Virus. www.clinicaltrial.gov 2012.

PRACE POGLĄDOWE

Adres do korespondencji: Lek. Aleksandra Bruś-Chojnicka Oddział Ginekologii i Położnictwa, Szpital Wojewódzki w Poznaniu, ul. Juraszów 7/19 60-479 Poznań email: [email protected]

Nowiny Lekarskie 2011, 80, 4, 299–304

BARBARA KUCZYŃSKA, AGNIESZKA WASILEWSKA, MACIEJ BICZYSKO, TOMASZ BANASIEWICZ, MICHAŁ DREWS

KRÓTKOŁAŃCUCHOWE KWASY TŁUSZCZOWE – MECHANIZMY DZIAŁANIA, POTENCJALNE ZASTOSOWANIA KLINICZNE ORAZ ZALECENIA DIETETYCZNE SHORT CHAIN FATTY ACIDS – MECHANISMS OF ACTION, POTENTIAL CLINICAL INDICATIONS AND NUTRITIONAL INDICATIONS Katedra i Klinika Chirurgii Ogólnej, Chirurgii Onkologii Gastroenterologicznej i Chirurgii Plastycznej Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu Kierownik: prof. dr hab. Michał Drews

Streszczenie Kwas masłowy, należący do grupy krótkołańcuchowych kwasów tłuszczowych (SCFA), określany jako maślan, posiada niejednokrotnie udowodnione korzystne działanie na przewód pokarmowy. Ze względu na działanie przeciwzapalne oraz stymulujące regenerację, SCFA mogą być skuteczne w zapobieganiu zapaleniom w obrębie jelita grubego. Stąd zastosowanie maślanu wspomagające terapię m.in. nieswoistych chorób zapalnych jelit, u pacjentów z zapaleniem po proktokolektomii czy w zespołach poresekcyjnych, po radioterapii, jak również w uchyłkowatości. Ponadto wykazuje działanie normalizujące w różnego rodzaju zaburzeniach czynnościowych jelit, prawdopodobnie zmniejsza także ryzyko nowotworzenia, odgrywa również rolę w leczeniu infekcji przewodu pokarmowego. Najkorzystniejszą drogą dostarczenia kwasu masłowego jest dobrze zbilansowana dieta, dodatkowo wzbogacona zarówno w pro-, jak i prebiotyki, jak również – stanowiące główny substrat do powstania endogennych SCFA – włókno pokarmowe. Dzięki temu możliwe jest utrzymanie wystarczającego poziomu kwasu masłowego dla prawidłowego przebiegu procesów regeneracji i odnowy nabłonka błony śluzowej jelita. Obecnie obserwuje się jednak coraz większy udział w codziennym żywieniu produktów wysoko przetworzonych, bogatych w cukry proste, z niedostateczną podażą błonnika, co w znacznym stopniu wpływa na obniżenie poziomu endogennych SCFA. Dlatego alternatywę zwiększenia puli maślanu w jelicie może stanowić suplementacja, zapewniająca jego stopniowe, powolne uwalnianie na całym odcinku przewodu pokarmowego. SŁOWA KLUCZOWE: krótkołańcuchowe kwasy tłuszczowe, kwas masłowy, nieswoiste zapalenia jelit, choroba uchyłkowa, zespół jelita drażliwego, nowotwory jelita grubego.

Summary Butyric acid belongs to a group of short-chain fatty acids (SCFA), with many well documented, beneficial roles in the gastrointestinal track. Because of regeneration stimulating function in intestines, SCFA may be effective in preventing inflammation. Hus, butyrate is used to support therapy in inflammatory bowel diseases, in patients after proctocolectomy, radiotherapy, after intestine resection and pouchitis. In addition, has been shown to exert normalizing effect on the different types of intestine functional disorders. Butyric acid probably reduces also risk of cancer, and plays a role in the treatment of gastrointestinal infections. The most preferred source of butyrate, is a well balanced diet, enriched both in pro- and prebiotics, and fiber as the most important substrate of endogenous SCFA. Thus, it is possible to maintain a sufficient level of butyric acid for normal processes of regeneration and renewal of epithelial intestine cells. Nowadays an increasing share of daily nutrition with highly processed products is observed, high in simple sugars and an insufficient intake of fiber. Therefore, an alternative, increasing the level of butyrate in the intestine, could be a supplementation, which provides the gradual and slow release of butyrate along the entire gastrointestinal tract. KEY WORDS: short chain fatty acids, butyric acid, inflammatory bowel diseases, diverticulosis, irritable bowel syndrome, large bowel neoplasia.

Krótkołańcuchowe kwasy tłuszczowe i ich rola w organizmie Krótkołańcuchowe kwasy tłuszczowe (ang. Short Chain Fatty Acids – SCFA) stanowią produkt beztlenowej fermentacji bakteryjnej włókna pokarmowego i skrobi opornej. Ich dobowa produkcja w jelicie grubym u zdrowego człowieka wynosi 300–400 mmol [1, 2]. Całkowite stężenie SCFA w świetle jelita waha się pomiędzy 60 a 150 mmol/kg, przy czym proporcje wynoszą odpowiednio dla: octanu, propio-

nianu i maślanu 60:25:15. Kwasy te odgrywają istotną rolę w regulacji pH, zwiększeniu wchłaniania wapnia, żelaza oraz magnezu w jelitach, a także korzystnie oddziałują na metabolizm glukozy i białek w wątrobie. Podstawowym źródłem energii dla kolonocytów jest maślan, drugim z kolei octan, a na końcu metabolizowany jest propionian. W przewodzie pokarmowym człowieka kwas masłowy najszybciej produkowany i absorbowany jest w okrężnicy wstępującej. Natomiast względnie wolno jego produkcja zachodzi w esicy i odbytnicy, pomimo iż stanowi główne źródło energii

PRACE POGLĄDOWE

300

Barbara Kuczyńska i inni

dla kolonocytów tego odcinka jelita, a także jest istotnym czynnikiem stymulującym wzrost i różnicowanie kolonocytów. Fizjologiczne stężenie maślanu w świetle jelita mieści się w granicach 1–10 mmol/l treści pokarmowej [1]. SCFA odgrywają niezwykle ważną rolę w utrzymywaniu prawidłowej struktury, integralności oraz funkcji jelita. Poprzez stymulację wzrostu flory saprofitycznej działają hamująco na rozwój innych patogenów, jak Escherichia coli, Campylobacter czy Salmonella, konkurujących o miejsce kolonizacji [2]. Istotną funkcją SCFA w organizmie, potwierdzoną w wielu dotychczasowych badaniach klinicznych, jest efekt troficzny wywierany na nabłonek jelitowy. Działanie to związane jest z przyspieszaniem procesów gojenia oraz regeneracji. Spośród trzech głównych SCFA najbardziej korzystne działanie w tym zakresie obserwuje się w przypadku kwasu masłowego. Poprzez wspomaganie funkcji bariery jelitowej, mierzonej jako zwiększenie elektrycznego oporu trans-nabłonkowego (Transepithelial Electrical Resistance, TER), dzięki fizjologicznemu stężeniu (2 mM) kwas masłowy wpływa na zmniejszenie przepuszczalności dla inuliny. Wykazuje również działanie stymulujące biosyntezę śluzu błony śluzowej nabłonka jelitowego. Co ważne, jego obecność w świetle jelita pozwala na utrzymanie prawidłowego pH, tym samym zabezpieczając układ pokarmowy przed inwazją mikroorganizmów. Badania prowadzone na zwierzętach potwierdziły opisane wyżej działanie SCFA. Wykazano, iż podanie prosiętom SCFA, przede wszystkim maślanu sodu, wpływało na zwiększenie przyrostu masy ciała zwierząt, zmniejszenie występowania owrzodzeń żołądka, zwiększenie liczby komórek wyścielających kosmki w jelicie krętym, wzrost wysokości kosmków, a także zwiększenie liczby komórek w kryptach oraz głębokości krypt w kątnicy [1, 3, 4]. Z kolei w badaniu na szczurach, po redukcji poziomu kwasu masłowego w świetle jelit, a tym samym zmniejszeniu ilości substratów dostępnych dla kolonocytów, wykazano zwiększoną atrofię błony śluzowej okrężnicy. Następnie podanie maślanu indukowało regenerację błony śluzowej, wzrost jej masy, syntezy DNA oraz głębokości krypt jelitowych. Działanie to dotyczy również redukcji atrofii błony śluzowej jelit w następstwie przewlekle prowadzonego żywienia pozajelitowego [1]. Prawdopodobnie SCFA wywierają silny troficzny efekt na śluzówkę wyłączonego z pasażu fragmentu jelita grubego, dzięki stymulacji wzrostu lokalnego przepływu krwi w błonie śluzowej oraz parametrów histologicznych. Wpływ SCFA na mikrokrążenie odbywa się poprzez bezpośrednie działanie na tętniczki oporowe (główny regulator przepływu krwi w narządzie), jak również ogólne nasilenie metabolizmu. SCFA mogą także stymulować angiogenezę, zwiększając całkowitą liczbę naczyń włosowatych, efekt ten nie jest jednak w pełni potwierdzony [3].

PRACE POGLĄDOWE

Wytwarzanie krótkołańcuchowych kwasów tłuszczowych w przewodzie pokarmowym i rola żywienia w utrzymaniu prawidłowego poziomu SCFA Endogenne SCFA powstają na drodze fermentacji bakteryjnej tzw. niestrawnych węglowodanów i oligomerów heksozy o rozmaitym stopniu polimeryzacji. Do bakterii produkujących SCFA należą głównie bakterie fermentujące cukry, jak: Clostridium spp., Eubacterium spp., Fusobacterium spp., Butyrivibrio spp. oraz Megasphaera elsdenii i Mitsuokella multiacida, Rosburia intestinalis, Faecalibacterium prausnitzii oraz Eubacterium halli. Do niestrawnych węglowodanów pochodzenia roślinnego należą: skrobia oporna, nieskrobiowe polisacharydy, oligosacharydy zaliczane do prebiotyków (tj. inulina), oligofruktoza, dwusacharydy (laktoza), stachioza, rafinoza i alkohole (sorbitol oraz mannitol). Z kolei do puli endogennej zalicza się między innymi mucyny i oligosacharydy mleka, stanowiące istotne źródło kwasu masłowego u noworodków i niemowląt. Fermentacja bakteryjna prowadzi do powstania kwasu octowego, propionowego i masłowego oraz w znacznie mniejszych ilościach kwasu mlekowego, sukcynylowego i kapronowego, a także dwutlenku węgla i wodoru. Wykazano również niewielki udział procesów fermentacji białka pokarmowego w wytwarzaniu SCFA, jednak sięga on zaledwie ok. 5% wszystkich wytwarzanych w okrężnicy kwasów [1]. Kwas masłowy w jelicie grubym powstaje głównie na drodze rozkładu pentoz, natomiast istotne działanie stymulujące na powstawanie maślanu wywiera prebiotyk w postaci kwasu glukonowego. U człowieka źródłem kwasu masłowego wytwarzanego endogennie w jelicie grubym są niestrawione węglowodany, tzn. te, które zdołają uniknąć rozkładu w żołądku i jelicie cienkim, a do których zaliczamy skrobię oporną oraz nierozpuszczalne frakcje włókna pokarmowego [1]. Do produktów szczególnie bogatych we włókno pokarmowe i skrobię oporną zaliczamy: produkty pełnoziarniste, otręby oraz nieprzetworzone płatki zbożowe, orzechy oraz ciemne makarony, pieczywo razowe, brązowy ryż, grube kasze; warzywa takie jak: rośliny strączkowe (groch, fasola, bób, soja), marchew, kapustę (zarówno surową, jak i kwaszoną), buraki, szpinak, sałatę, pomidory, ziemniaki; owoce: jeżyny, porzeczki, śliwki, gruszki, czarne jagody, jabłka, brzoskwinie, pomarańcze, kiwi oraz suszone owoce. Najlepsze efekty uzyskuje się, wzbogacając dietę w złożone mieszaniny różnych frakcji włókna pokarmowego, pochodzących zarówno ze zbóż, warzyw, jak i owoców [5]. Jak wykazuje Bird i wsp., istnieje dodatnia korelacja pomiędzy zwiększonym spożyciem produktów zawierających skrobię oporną a poziomem maślanu badanego w kale, co z kolei ujemnie korelowało z występowaniem ryzyka chorób jelita grubego o podłożu dietozależnym, czyli między innymi nowotworów [6]. Inne badania,

Krótkołańcuchowe kwasy tłuszczowe – mechanizmy działania, potencjalne zastosowania kliniczne oraz zalecenia dietetyczne

Krutsena i wsp., potwierdziły korzystny wpływ diety bogatobłonnikowej na produkcję maślanu w świetle jelita. Badanych pacjentów podzielono na dwie grupy. Dieta pierwszej z nich opierała się na zwiększeniu spożycia pieczywa żytniego, dostarczającego więcej błonnika niż pieczywo pszenne zastosowane w drugiej grupie badanej [7]. Istotne korzyści podaży włókna pokarmowego potwierdzają badania Hallerta i wsp. prowadzone wśród pacjentów z wrzodziejącym zapaleniem jelita grubego w okresie remisji. Chorym zwiększono podaż błonnika o 20 g, co odpowiadało podaży 60 g płatków owsianych. Po 4 tygodniach terapii zaobserwowano wzrost poziomu maślanu w kale o 36%, a po 12 tygodniach doszło do znacznego złagodzenia dolegliwości brzusznych zgłaszanych przez pacjentów. Pomimo że efekt ten mijał po kolejnych 3 miesiącach, uznano, iż zwiększone spożycie błonnika pokarmowego można traktować jako bezpieczną kurację podtrzymującą w okresie remisji choroby [8]. W licznych badaniach próbowano zwiększać poziom a zarazem korzystny wpływ endogennego maślanu przez dodatkowe rozszerzanie diety w prebiotyki, tj. fruktooligosachardy (FOS) oraz probiotyki, głównie szczepy Lactobacillus spp. i Bifidobacterium spp. Badano także interakcje wprowadzonych do diety produktów bogatych we włókno pokarmowe i skrobię oporną z równocześnie podawanymi wielonienasyconymi kwasami tłuszczowymi n-3 w postaci w tłuszczów ryb morskich. Poszerzanie diety o wyżej wymienione składniki za każdym razem pozytywnie wpływało na utrzymanie homeostazy i prawidłowej funkcji jelit, jednak nie udało się uzyskać jednoznacznych wyników potwierdzających ich korelację z działaniem maślanu [2, 9, 10, 12]. Pomimo licznych dowodów stymulującego wpływu diety bogatoresztkowej na wzrost poziomu kwasu masłowego w świetle jelita, należy wziąć pod uwagę, że u pacjentów, u których pożądane jest osiągnięcie efektów zastosowanej terapii maślanem, spożycie zwiększonej ilości ciężkostrawnego włókna pokarmowego zbytnio obciąża organizm i może prowadzić do nasilenia objawów choroby. Dlatego w sytuacjach, gdy niemożliwe jest zapewnienie dostarczenia w pożywieniu substratów niezbędnych do wytworzenia endogennego kwasu masłowego, optymalnym rozwiązaniem wydaje się wprowadzenie suplementacji preparatami maślanu sodu, umożliwiającymi jego wykorzystanie niezależnie od kondycji mikroflory jelitowej [1, 5, 8]. W warunkach prawidłowo zbilansowanej diety, zapewniającej podaż w odpowiednich proporcjach białka, węglowodanów i tłuszczów oraz dodatkowo wzbogaconej zarówno w pro-, jak prebiotyki, poziom SCFA, w tym kwasu masłowego, jest wystarczający dla prawidłowego przebiegu procesów regeneracji i odnowy nabłonka błony śluzowej jelita. Jednak obecnie obserwuje się coraz większy udział w codziennym żywieniu produktów wysoko przetworzonych, bogatych w cukry proste, z niedostateczną podażą włókna pokarmowego, co w znacznym stopniu wpływa na obniżenie poziomu

301

endogennych SCFA. Podaż doustna egzogennych postaci SCFA, w tym przede wszystkim maślanu czy jego soli, łączy się z dość specyficznym, nieprzyjemnym smakiem i zapachem. Jednocześnie jego bardzo szybkie wchłanianie w górnym odcinku przewodu pokarmowego powoduje, że praktycznie nie dociera on do jelita grubego. Dlatego zwiększenie stężenia kwasu masłowego w pokarmie nie rozszerza obszaru jego oddziaływania, stąd nie może stanowić optymalnego rozwiązania zwiększenia jego poziomu w organizmie. Obecnie opracowano technologię tzw. mikrootoczkowania maślanu czyli zabezpieczenia go w matrycy lipidowej. Metoda ta pozwoliła na zneutralizowanie jego właściwości smakowozapachowych oraz umożliwiła stopniowe, powolne uwalnianie w całym odcinku przewodu pokarmowego. Jest to jedna z możliwości podawania maślanu, pozwalająca na pełne wykorzystanie jego dobroczynnego działania na błonę śluzową jelita grubego [1, 5, 8]. Mechanizmy działania krótkołańcuchowych kwasów tłuszczowych Działanie przeciwzapalne: Jednym z najlepiej poznanych działań SCFA jest działanie przeciwzapalne. Opiera się ono się na hamowaniu aktywności mediatorów zapalnych w nabłonku jelitowym, a więc inhibicji aktywacji NFκB makrofagów, które są głównym źródłem cytokin w przebiegu procesu zapalnego nieswoistych chorób zapalnych jelit. Najsilniejszy efekt przeciwzapalny wydaje się wywierać kwas masłowy i jego sole. Maślan sodu wykazuje zdolność do redukcji sekrecji IL-8, co w sposób istotny przyczynia się do blokowania przeciwzapalnej kaskady cytokin na poziomie lokalnym. Jest to szczególnie pożądany efekt w przewlekłych stanach zapalnych, takich jak choroba LeśniowskiegoCrohna i wrzodziejące zapalenie jelita grubego, gdy po zastosowaniu maślanu dochodzi do znacznej poprawy stanu błony śluzowej jelit. Efekt ten, obserwowany w badaniu klinicznym, endoskopowym i histologicznym, polega na zmniejszeniu liczby makrofagów i neutrofili w kryptach oraz na powierzchni nabłonka jelitowego i prowadzi do zahamowania dalszego rozwoju choroby [1, 3, 5, 6]. Działanie czynnościowe: Działanie przeciwzapalne oraz troficzne SCFA, jak również regulacja procesów wchłaniania zwrotnego wody i sodu w jelicie, normalizacja flory bakteryjnej, a także korzystny wpływ na motorykę jelit i regulację rytmu oddawania stolca, pozwalają na włączenie SCFA do kompleksowej terapii leczenia zaburzeń czynnościowych jelit, w tym biegunek, niezależnie od ich etiologii [3, 7]. Najsilniejszy i najlepiej poznany efekt dotyczy również kwasu masłowego i jego soli. W modelu doświadczalnym maślan sodu wpływa korzystnie na zmniejszenie nadwrażliwości receptorów jelitowych, co prowadzi do spadku amplitudy ciśnienia śródjelitowego. Wykazano, iż kwas masłowy zwiększa efektywność perystaltyczną jelita grubego poprzez poprawę kurczliwości mięśniówki okrężnej, jak i regulujący wpływ na neuro-

PRACE POGLĄDOWE

302

Barbara Kuczyńska i inni

przekaźnictwo jelitowe, szczególnie w przypadku spowolnionej perystaltyki. Po bezpośrednim podaniu maślanu pacjenci zgłaszali zmniejszenie odczuwania bólu trzewnego, co prawdopodobnie związane jest z korzystnym wpływem na neurony jelitowe [5]. Dodatkową skuteczność maślanu w ograniczaniu jelitowego wydzielania wody, sodu, chloru i potasu potwierdzają obserwacje kliniczne pacjentów chorych na cholerę po podaniu włókna pokarmowego oraz skrobi kukurydzianej bogatej w amyloid, które zwiększają produkcję SCFA w jelicie. SCFA z kolei zapobiegają ciężkim stanom odwodnienia [7], co tłumaczy ich zastosowanie w przypadku biegunek. Najsilniejsze działanie dotyczy maślanu, który dodatkowo przez łagodzenie odczynu zapalnego zmniejsza intensywność oraz czas trwania biegunki [3]. Działanie przeciwnowotworowe: SCFA odgrywają również rolę w procesach indukcji proliferacji oraz apoptozy – programowanej śmierci komórki. Ich duże stężenie, szczególnie kwasu masłowego w jelicie grubym, może powstrzymywać zarówno wczesne, jak i późne etapy onkogenezy poprzez kontrolę transkrypcji, a także ekspresję i aktywację kluczowych białek w kaskadzie apoptotycznej. Działanie to odnosi się głównie do hamowania wzrostu komórek nowotworowych. Przeciwnowotworowa aktywność maślanu polega na hamowaniu cyklu komórkowego, stymulacji różnicowania komórek nowotworowych oraz indukcji apoptozy przekształconych kolonocytów. Jest to tzw. „paradoks maślanu”, który z jednej strony prowadzi do stymulacji proliferacji prawidłowych komórek nabłonka błony śluzowej jelita, a z drugiej do zahamowania proliferacji komórek nowotworowych. Co ważne, działania takiego nie obserwuje się w przypadku pozostałych SCFA. Natomiast podobną reakcję na obecność maślanu wykazują komórki prawidłowe i zmienione nowotworowo, nie wywodzące się z nabłonka okrężnicy (jak komórki raka piersi, nerki, trzustki, a także komórki guzów litych i białaczkowych) [1, 3]. Wybrane jednostki chorobowe, w leczeniu których uzasadnione jest zwiększenie podaży krótkołańcuchowych kwasów tłuszczowych

Nieswoiste choroby zapalne jelit: Jest to wspólne określenie dla grupy schorzeń związanych z powstaniem i rozwojem zapalnych zmian patologicznych w obrębie jelita cienkiego i grubego. Podstawowe jednostki chorobowe tej grupy to wrzodziejące zapalenie jelita grubego (WZJG) oraz choroba Leśniowskiego-Crohna (ChL-C). Schorzenia te stanowią coraz istotniejszy problem zdrowotny w krajach wysoko uprzemysłowionych, głównie ze względu na stały wzrost liczby zachorowań i występowanie najczęściej u osób młodych, aktywnych zawodowo. Podłoże tych chorób stanowią mutacje genetyczne udokumentowane obecnie w wielu chromosomach, natomiast do wywołania pierwszych objawów predysponują tzw. czynniki spustowe, wśród których wymienia się m.in.: czynniki dietetyczne (zmniejszenie ilości błonnika, toksyczne działanie substancji chemicznych, jak

PRACE POGLĄDOWE

utrwalacze czy barwniki), czynniki środowiskowe (wzrost zanieczyszczenia środowiska, papierosy), działanie wolnych rodników, zakażenia bakteryjne (m.in. Mycobacterium paratuberculosis spp., Salmonella spp., Shigella spp.) i wirusowe (m.in. wirus odry, Cytomegalovirus). SCFA w leczeniu i zaleceniach dietetycznych u chorych z nieswoistymi chorobami zapalnymi jelit podawane są najczęściej doustnie, wywierając korzystny efekt przeciwzapalny, jak i przyspieszając poprzez działanie troficzne procesy naprawy i regeneracji. Efekt przeciwzapalny polega przede wszystkim na hamowaniu aktywności mediatorów zapalnych w nabłonku jelitowym, głównie inhibicji aktywacji NFκB makrofagów, które są głównym źródłem cytokin w przebiegu procesu zapalnego nieswoistych chorób zapalnych jelit. Bezpośrednim efektem jest zmniejszenie liczby makrofagów i neutrofili w kryptach oraz na powierzchni nabłonka jelitowego, co pozwala na zahamowanie dalszego rozwoju choroby. Skuteczność podawania nasion babki szerokolistnej (Plantago ovata), z których podczas fermentacji jelitowej wytwarzany jest maślan, była podobna do skuteczności mesalazyny w podtrzymaniu remisji WZJG [9]. Suplementacja krótkołańcuchowych kwasów tłuszczowych pod postacią wlewek doodbytniczych pozwala na wzmocnienie właściwości obronnych błony śluzowej, poprawę mikrokrążenia, a tym samym przyspiesza gojenie się owrzodzeń poprawia metabolizm kolonocytów, co prowadzi do przyspieszenia ich wzrostu i dojrzewania [10]. Zapalenie zbiornika jelitowego (pouchitis): Ze względu na stały wzrost częstości występowania WZJG a także lepszą diagnostykę w rodzinach z polipowatością przewodu pokarmowego, mamy do czynienia ze zwiększeniem ilości pacjentów po proktokolektomii (usunięciu całego jelita grubego) z wytworzeniem zbiornika jelitowego (z końcowego odcinka jelita krętego). Zapaleniu zbiornika towarzyszą bóle brzucha, wyniszczenie, luźne stolce z domieszką śluzu i krwi, niemożność wstrzymania stolca oraz podwyższona ciepłota ciała. Najtrudniejszym problemem jest jednak biegunka, która może szybko doprowadzić do ciężkiego odwodnienia. Etiologia tego zapalenia jest cały czas nieznana, a częstość waha się od 7–45%. SCFA pełnią istotną rolę w leczeniu jako element wspomagający podstawową terapię. Wydaje się jednak, iż ich główna rola polega na profilaktyce zapalenia poprzez stały efekt troficzny, korzystny wpływ na florę bakteryjną oraz wpływ na integralność bariery jelitowej. Uchyłkowatość jelita grubego: Uchyłkowatość jelita grubego to schorzenie, którego częstość zależy od czynników geograficzno-ekonomicznych (znacznie częstsze występowanie w krajach tzw. „bogatej Północy” niż „ubogiego Południa”), dietetycznych (dieta wysoko przetworzona, skąpobłonnikowa), środowiskowych (zaparcia, siedzący tryb życia). Częstość występowania uchyłkowatości jelita grubego wzrasta wraz z wiekiem i u osób powyżej 85. roku życia sięga 50% przypadków (badania post mortem), choć objawy kliniczne występują zdecydowanie rzadziej. Leczeniem z wyboru w postaciach niepowikłanych perforacją, niedrożnością lub za-

Krótkołańcuchowe kwasy tłuszczowe – mechanizmy działania, potencjalne zastosowania kliniczne oraz zalecenia dietetyczne

paleniem otrzewnej jest leczenie zachowawcze. Ze względu na mechanizm przeciwzapalny oraz stymulujący regenerację, SCFA mogą być skuteczne w zapobieganiu zapaleniom. Zaburzenia czynnościowe przewodu pokarmowego: Stanowią one bardzo dużą grupę schorzeń, dotyczyć mogą bowiem nawet ok. 15% populacji. Zdecydowana większość z nich dotyczy zespołów jelita drażliwego i przewlekłych zaparć. W ich etiopatogenezie wyróżnia się przede wszystkim czynniki środowiskowo-dietetyczne, tryb życia i obciążenie stresem. Występują przede wszystkim w krajach wysoko rozwiniętych, nie spotyka się ich natomiast w ubogich rejonach, np. Afryki czy Azji. Wykazano, iż SCFA, przede wszystkim kwas masłowy, zwiększają efektywność perystaltyczną jelita grubego poprzez poprawę kurczliwości mięśniówki okrężnej i regulujący wpływ na neuroprzekaźnictwo jelitowe, szczególnie w przypadku spowolnionej perystaltyki. Po bezpośrednim podaniu maślanu pacjenci zgłaszali zmniejszenie odczuwania bólu trzewnego, co prawdopodobnie związane jest z korzystnym wpływem na neurony jelitowe [5]. Nowotwory dolnego odcinka przewodu pokarmowego: Rak jelita grubego (RJG) stanowi 9% wszystkich nowotworów. Obecnie w Europie szacuje się występowanie raka okrężnicy na 250 tys. nowych przypadków rocznie [11], natomiast raka odbytnicy stwierdza się w ok. 15–25 przypadków na 100 tys./rok [12]. Z danych statystycznych z 2010 roku wynika, że na świecie RJG zajmuje trzecie miejsce wśród zachorowań na nowotwory po raku prostaty i oskrzeli u mężczyzn oraz raku sutka i oskrzeli u kobiet, a także trzecie miejsce wśród przyczyn zgonów – po raku oskrzeli i prostaty u mężczyzn oraz oskrzeli i sutka u kobiet. Częstość zachorowań wzrasta wraz z industrializacją i urbanizacją [11]. Mimo postępu wiedzy na temat biologii raka jelita grubego i ciągłego doskonalenia metod operacyjnych, odsetek przeżyć pięcioletnich u chorych operowanych z powodu RJG jest wciąż daleki od oczekiwań. Rokowanie jest szczególnie złe u chorych z zaawansowaną chorobą nowotworową. Istnieje szereg ciekawych badań in vitro, wykazujących zdolność SCFA do powstrzymywania wczesnych i późnych etapów onkogenezy poprzez kontrolę transkrypcji, ekspresji i aktywacji kluczowych białek w kaskadzie apoptotycznej [13]. Istotny jest również efekt apoptotyczny SCFA, przede wszystkim maślanu. Badania eksperymentalne na hodowlach tkankowych wykazały, że usunięcie maślanów już po 45 minutach powoduje apoptozę kolonocytów [14]. Wykazano również, że obecność maślanów działa indukująco na apoptozę linii nowotworowych komórek nabłonka jelita grubego, potencjalnie zapobiegając rozwojowi raka [15]. Wyniki badań in vitro mogą skłaniać do zaleceń dotyczących zwiększenia podaży SCFA w diecie jako czynnika o działaniu potencjalnie zmniejszającym ryzyko nowotworzenia. Należy jednak zdecydowanie podkreślić, iż SCFA nie stanowią żadnej formy leczenia chorób nowotworowych w świetle medycyny opartej na faktach (EBM).

303

Ostre infekcje wirusowe i bakteryjne przewodu pokarmowego: Są to niezwykle częste schorzenia określane przez pacjentów i lekarzy jako „grypa jelitowa” czy biegunka wirusowa lub bakteryjna. Podstawowym objawem jest trwająca od jednego do kilku dni biegunka, w zdecydowanej większości nie wymagająca leczenia szpitalnego czy dożylnego, a jedynie dbania o odpowiednie nawodnienie i stosowania leków objawowych. Grupy szczególnie narażone na te infekcje to dzieci, osoby starsze, osoby z osłabieniem odporności, w trakcie immunosupresji, chorujące na inne schorzenia. Choroba ta uwarunkowana jest nawykami środowiskowohigienicznymi i generalnie należy do tzw. grupy „chorób brudnych rąk”. Specyficzną formą tej grupy schorzeń są dysbiozy po antybiotykoterapii, w trakcie której i bezpośrednio po której nie zastosowano probiotyków. SCFA działają regulująco na procesy wchłaniania zwrotnego wody i sodu w jelicie, normalizację flory bakteryjnej, a także mają korzystny wpływ na motorykę jelit i regulację rytmu oddawania stolca. Ich przeciwzapalne i troficzne działanie powoduje, iż są one istotnym elementem terapii biegunek, niezależnie od ich etiologii [3, 7]. Biegunka podróżnych: Definicja tego ostrego schorzenia jest dość szeroka i dotyczy wszelkich epizodów biegunek związanych z przemieszczaniem się ludzi poza swoją strefę zamieszkania. Spowodowana jest infekcją wirusową lub bakteryjną przewodu pokarmowego. Czynnikiem sprawczym są zazwyczaj drobnoustroje o niskiej patogenności dla mieszkańców danego rejonu. Proponowane leki mają charakter jedynie objawowy i często przy ich stosowaniu objawy zmniejszają się jedynie chwilowo, powracając z większą intensywnością. Wydaje się, iż sugerowane działanie osłonowe i lecznicze SCFA, przede wszystkim kwasu masłowego, polega na zmniejszeniu adhezji patogenów do ściany jelita, aktywacji układu odpornościowego, w tym makrofagów i komórek tucznych, działania przeciwzapalnego i przeciwutleniaczowego. Istotna jest również zdolność SCFA do zapobiegania ciężkim stanom odwodnienia [7] oraz stymulacja wzrostu flory saprofitycznej, działającej hamująco na rozwój innych patogenów, jak Escherichia coli, Campylobacter czy Salmonella, konkurujących o miejsce kolonizacji [1]. Inne schorzenia: Inne choroby mogące być potencjalnie wskazaniami do stosowania SCFA to schorzenia występujące rzadziej, choć ich nasilenie kliniczne czy wpływ na funkcjonowanie pacjentów może być bardzo duży. Często są to stany kliniczne, w których brak skutecznego modelu leczenia farmakologicznego lub też leczenie takie jest bardzo kosztowne bądź trudne dla chorego. Wymienić wśród nich można: – zespoły poresekcyjne. Występują po odcinkowych resekcjach przewodu pokarmowego w zakresie uniemożliwiającym adaptację pozostałego odcinka jelita zapewniającą normalne funkcjonowanie i pełne zbilansowanie metaboliczne. Ich główną przyczyną są rozległe resekcje jelita cien-

PRACE POGLĄDOWE

304

Barbara Kuczyńska i inni

kiego w przebiegu zmian zatorowo-niedokrwiennych, krwotocznych (angiodysplazje), wieloogniskowej lub nawrotowej ChL-C, rozległych zrostów i niedrożności mechanicznej po uprzednich zabiegach chirurgicznych, zmian urazowych oraz nowotworów. – tzw. diversion colitis, tj. to zapalenie dystalnego, wyłączonego (stomia jednolufowa, końcowa, tzw. zabieg sposobem Hartmanna) lub wyłączonego z pasażu (stomia dwulufowa) odcinka przewodu pokarmowego, najczęściej jelita grubego. Wskutek zastoju treści jelitowej (bakterie, złuszczone nabłonki, wydzielina śluzowa), trudności w pasażu, nieprawidłowego odżywiania komórek nabłonka błony śluzowej (częściowo wykorzystujących bezpośrednio wchłaniane związki) dochodzi do zaburzeń w obrębie błony śluzowej, zmniejszenia szczelności bariery „krew-jelito” oraz zaburzenia naturalnego cyklu regeneracji nabłonka jelitowego. – stany po radioterapii (radiation colitis). Coraz powszechniejsze wprowadzanie radioterapii w leczeniu nowotworów odbytnicy i odbytu, poprawa wyników leczenia i zwiększenie odsetka pacjentów we wszystkich grupach szacowanych czasów przeżycia powoduje, iż odczyn zapalny dolnego odcinka przewodu pokarmowego, najczęściej odbytnicy, staje się coraz częstszym problemem. Nasilenie zmian w przebiegu odczynu popromiennego jest bardzo zmienne. Niewielkie objawy kliniczne dotyczące głównie dolegliwości bólowych o małym i średnim nasileniu, okresowych biegunek czy krwawień, występują u około 1530% chorych poddanych radioterapii. Odczyny o większym nasileniu, będące czasem przyczyną wyłonienia stomii czy nawet brzuszno-kroczowej resekcji odbytnicy, dotyczą tylko niewielkiego odsetka chorych (2–3%). Biorąc jednak pod uwagę rosnącą liczbę zachorowań oraz wskazań do radioterapii przed- lub pooperacyjnej w nowotworach odbytnicy, a także coraz większą świadomość lekarzy i dostępność radioterapii, należy liczyć się ze wzrostem liczby tych odczynów. SCFA stosowane miejscowo wydają się odgrywać potencjalnie korzystną rolę w leczeniu tego rodzaju odczynów zapalnych. Wyniki części badań wydają się potwierdzać ich skuteczność, szczególnie w krótkim okresie stosowania [16]. Piśmiennictwo 1. Kotunia A., Pietrzak P., Guilloteau P. i wsp.: Kwas masłowy w przewodzie pokarmowym. Przegl. Gastr., 2010, 5(3), 117–122.

PRACE POGLĄDOWE

2. Roediger W.E:. Role of anaerobic bacteria in the metabolic welfare of the colonic mucosa in man. Gut, 1980, 21, 793-798. 3. Hijova E., Chmelarova A.: Short chain fatty acids and colonic health. Bratisl Lek Listy, 2007, 108(8), 354-358. 4. Topping D., Clifton P.: Short-chain fatty acids and human colonic function: Roles of resistant starch and nonstarch polysaccharides. Physiol. Rev., 2001, 81(3),1031-1064. 5. Banasiewicz T., Kaczmarek E., Maik J. i wsp.: Jakość życia i objawy kliniczne u chorych z zespołem jelita nadwrażliwego, leczonych uzupełniająco chronionym maślanem sodu. Gastr. Prakt., 2011, 3(5), 45-53. 6. Bird A.R., Conlon M.A., Christophersen C.T. i wsp.: Resistant starch, large bowel fermentation and a broader perspective of prebiotics and probiotics. Benef. Microb., 2010, 1(4), 423-431. 7. Knudsen K.E., Serena A., Conibe N. i wsp.: New insight into butyrate metabolism. Pro. Nutr. Soc., 2003, 62, 81-86. 8. Hallert C., Björck I., Nyman M. i wsp.: Increasing fecal butyrate in ulcerative colitis patients by diet: Controlled pilot study. Inflamm. Bow. Dis., 2003, 9(2), 116-121. 9. Krzesiek E.: Postępy w leczeniu nieswoistych zapaleń jelit. Now. Ped., 2002, 3, 179-184. 10. Kamińska B., Landowski P.: Rola wybranych czynników środowiskowych w etiopatogenezie nieswoistych zapaleń jelit. For. Med. Rodz., 2009, 3(1), 42–48. 11. Labianca R., Nordlinger B., Beretta G.D.: Primary colon cancer: ESMO Clinical Practice Guidelines for diagnosis – adjuvant treatment and follow-up. Ann. Oncol., 2010, 21(5), 70-77. 12. Glimelius B., Oliveira J.: Rectal cancer: ESMO Clinical Recommendations for diagnosis, treatment and followup. Ann. Oncol., 2009, 20(4), 54-56. 13. Whitehead R.H., Young G.P., Bhathal P.S.: Effects of short chain fatty acids on new human colon carcinoma cell line (LIM 1215). Gut, 1986, 27, 1436-1457. 14. Hass R., Busche R., Luciano L. i wsp.: Lack of butyrate is associated with induction of bax and subsequent apoptosis in the proximal colon of guinea pig. Gastroenterol., 1997, 112, 875-881. 15. Hague A., Manning A.M., Hanlon A.K. i wsp.: Sodium butyrate induces apoptosis in human colonic tumor cell lines in a p53 – independent pathway: implications for the possible role of dietary fibre in prevention of large bowel cancer. Int. J. Cancer, 1993, 55, 498-505. 16. Petryszyn P., Paradowski L.: Niechirurgiczne leczenie przewlekłego popromiennego zapalenia odbytnicy. Gastroenterol. Pol., 2006, 13(3), 211-214.

Adres do korespondencji: Tomasz Banasiewicz Katedra i Klinika Chirurgii Ogólnej, Chirurgii Onkologii Gastroenterologicznej i Chirurgii Plastycznej Uniwersytet Medyczny im. Karola Marcinkowskiego w Poznaniu ul. Przybyszewskiego 49 60-355 Poznań Tel.: 618691275 e-mail: [email protected]

Nowiny Lekarskie 2011, 80, 4, 305–311

EMILIA MIKOŁAJEWSKA

OBIEKTYWIZACJA WYNIKÓW REHABILITACJI – PRÓBA UJĘCIA KOMPLEKSOWEGO OBJECTIVIZATION OF REHABILITATION OUTCOMES – ATTEMPT OF A COMPLEX APPROACH Klinika Rehabilitacji 10 Wojskowy Szpital Kliniczny z Polikliniką SP ZOZ w Bydgoszczy Kierownik: płk dr n. med. Krzysztof Radziszewski

Streszczenie W związku ze wzrostem populacji osób niepełnosprawnych, ciężko chorych i w podeszłym wieku konieczne jest rozwijanie istniejących i znajdowanie nowych sposobów obiektywizacji wyników rehabilitacji. Artykuł stanowi wprowadzenie do zagadnień związanych z wpływem dowodów naukowych na efektywność rehabilitacji. Przedstawiona w artykule próba ujęcia kompleksowego stanowi próbę oceny, w jakim stopniu wykorzystuje się możliwości w tym obszarze. SŁOWA KLUCZOWE: rehabilitacja, fizjoterapia, obiektywizacja, dowody naukowe, Medycyna Oparta na Faktach.

Summary In the context of growing population of disabled, severely ill and older people is necessary to develop current and find new ways of objectivization of rehabilitation results. The paper introduces readers to problems associated with influence of evidences for the effectivity of rehabilitation. The mentioned in the article attempt of complex approach aims at investigating the extent to which the available opportunities are being exploited. KEYWORDS: rehabilitation, physical therapy, objectivization, evidences, Evidence Based Medicine.

Wprowadzenie Obiektywizacja oceny stanu pacjenta oraz wyników terapii jest niezbędna w każdej dziedzinie opieki zdrowotnej: dla potrzeb planowania i monitorowania promocji zdrowia, edukacji zdrowotnej, leczenia oraz opieki w zdrowiu i w chorobie. Obejmuje ona całokształt przedsięwzięć (także w ramach procesu diagnostycznego i decyzyjnego) mających na celu podwyższenie efektywności terapii oraz zmniejszenie ryzyka popełnienia błędu w terapii. Kluczowe jest zatem jak najszybsze ustalenie pierwotnych przyczyn zaobserwowanych objawów, a następnie wypracowanie diagnozy oraz wdrożenie zgodnego z nią postępowania terapeutycznego. Nowoczesna rehabilitacja musi nadążać za tymi trendami. Obiektywizacja wyników rehabilitacji jest nierozerwalnie związana z nowoczesnymi narzędziami diagnostycznymi oraz planowaniem terapii. Elementy obiektywizacji powinny występować na każdym etapie postępowania terapeutycznego. Chodzi o to, aby: – rozdzielić subiektywne obserwacje i odczucia lekarza/terapeuty od procedur klinicznych potwierdzonych wiarygodnymi i powtarzalnymi badaniami naukowymi – ograniczyć wpływ pierwszych z ww. na przebieg procesu decyzyjnego oraz postępowania terapeutycznego – sformalizować i w miarę możliwości ujednolicić opis procesów biologicznych zachodzących w organizmie (np. na potrzeby porównań między pa-

cjentami, metodami diagnostycznymi i terapeutycznymi itp.). Nie należy takiego podejścia mylić ze sztywnym trzymaniem się procedur i wytycznych klinicznych oraz ograniczaniem stosowania metod innowacyjnych lub uważanych za niesprawdzone. Standaryzacja oraz obiektywizacja nie zwalniają z indywidualnego myślenia, nie dostarczą również gotowych rozwiązań we wszystkich przypadkach. Jak w większości procesów decyzyjnych kluczem jest tu wiedza, doświadczenie oraz zdrowy rozsądek podejmującego decyzję (jednoosobowo lub kolektywnie). Dodatkowo należy jednoznacznie odróżnić postępowanie obiektywnie sprzeczne z powszechnie uznanymi zasadami wiedzy i praktyki medycznej, uznawane (w zależności od okoliczności) za błąd w sztuce (błędy: diagnostyczne, terapeutyczne, rokowania) bądź tzw. niedopełnienie przez personel medyczny obowiązku zachowania należytej staranności. Jak widać w zakresie obiektywizacji wyników rehabilitacji jest jeszcze znaczące pole do badań. Nakładają się na to braki w literaturze naukowej: niedostatek badań w tym zakresie widać wyraźnie na rycinie 1, przedstawiającej wyniki przeszukiwania bazy danych PubMed (U.S. National Library of Medicine) [1]. Tematowi obiektywizacji w naukach medycznych poświęca się zdecydowanie zbyt mało uwagi w badaniach naukowych, nie mówiąc już o metaanalizach czy wytycznych klinicznych. Niniejsza praca stanowi próbę podsumowania dotychczasowych osiągnięć z zakresu obiektywizacji wyników rehabilitacji, jak również wskazania możliwych kierunków rozwoju badań w tym obszarze.

PRACE POGLĄDOWE

306

Emilia Mikołajewska

ilość artykułów

134

Porównanie częstości występowania haseł

65 59

7

3

2

0

0

objectivization objectivization objectivization objectivization objectivization objectivization objectivization objectivization + + + + + + treatment + therapy traumatic spine cord physiotherapy rehabilitation stroke brain injury injury

nazwa hasła

Rycina 1. Wyniki wyszukiwania w bazie PubMed (U.S. National Library of Medicine) [1]. Figure 1. Results of screening the PubMed database (U.S. National Library of Medicine) [1].

Warto jednak podjąć wysiłek związany z pełnym wdrożeniem obiektywizacji wyników rehabilitacji. Przemawiają za tym następujące argumenty: 1. metody i techniki rehabilitacji, szczególnie w terapii wielodyscyplinarnej, powinny być nie mniej wiarygodne niż inne wykorzystywane metody (farmakoterapia, interwencje chirurgiczne itp.), szczególnie na potrzeby: – właściwego planowania terapii, oceny jej wyników oraz wprowadzania ewentualnych korekt – porównania dwóch lub więcej metod 2. każdy specjalista medyczny chce używać sprawdzonych i efektywnych metod terapeutycznych 3. każdy pacjent chce być leczony ww. metodami, szczególnie w ramach terapii zorientowanej na pacjenta (ang. patient-oriented therapy), jego cele i preferencje (ang. goal setting) [2]. Obiektywizacja jako element procesu diagnostycznego i terapeutycznego Nie ulega wątpliwości, że rozpoznanie choroby oraz zmiany w procesie terapeutycznym powinny być obiektywizowane wynikami badań. Podstawowym źródłem informacji w naukach medycznych jest obserwacja kliniczna [3]. Jej wynik, nawet będący wartością liczbową (pomiarem), może być jednak obarczony szeregiem błędów wynikających zarówno z przyjętej metody, zmienności obserwatora czy obserwowanego pacjenta. Stąd proces diagnostyczny i terapeutyczny, pomimo całej jego złożoności i obudowa-

PRACE POGLĄDOWE

nia metodykami pomiarów, musi uwzględniać fakt, że obserwacja kliniczna pacjenta może być niepewna, niekompletna i wielowymiarowa [3]. Dobór i wykorzystanie właściwych metod stanowi pole badań już całej gałęzi wiedzy: biometrii klinicznej (ang. clinometrics). Zasadnicze pomiary wyróżniane w naukach medycznych obejmują: – pomiar cech biofizycznych: morfometrycznych, kinetycznych, dynamicznych, właściwości bioelelektrycznych i biomagnetycznych tkanek i/lub narządów – pomiar biologicznych i biochemicznych składników płynów ustrojowych – pomiar psychologicznych i socjologicznych determinantów zdrowia i choroby [3]. Świadomość istnienia błędów pomiarowych oraz ich badanie prowadzi do uwzględniania ich w wynikach badań chociażby poprzez kalibrację urządzeń lub seryjne powtarzanie określonych procedur pomiarowych. Wynika to z faktu, że nadrzędnym celem każdej obserwacji i pomiaru jest uzyskanie wiarygodnej informacji odnośnie mierzonej cechy. Maksymalizacja rzetelności otrzymywanych wyników jest w tym przypadku równoważna minimalizacji błędów pomiarowych. W naukach medycznych i w praktyce klinicznej wykorzystuje się do tego celu m.in. różnego rodzaju modele procesów chorobowych, będące ich ścisłym matematycznym opisem. W praktyce klinicznej najistotniejsze wydają się modele decyzyjne, budowane w celu: – wspomagania decyzji diagnostycznych – prognozowania przebiegu procesu chorobowego [3].

Obiektywizacja wyników rehabilitacji – próba ujęcia kompleksowego

Celem ich stosowania jest identyfikacja choroby na podstawie danych klinicznych oraz minimalizacja błędu prognozy. W rzeczywistości źródło modeli decyzyjnych stanowią zwykle uproszczone modele eksplanacyjne, wyjaśniające mechanizmy badanego zjawiska (choroby, uszkodzenia, zmian itp.). Niestety – modele eksplanacyjne ze względu na dużą dokładność i złożoność oraz problemy z tzw. identyfikowalnością kliniczną tych modeli zwykle nie nadają się do bezpośrednich zastosowań klinicznych lub są w tych zastosowaniach nieefektywne [3]. Decyzja w zakresie diagnozy zapada w rezultacie wnioskowania statystycznego. W tym momencie należy podkreślić wiodącą obecnie rolę paradygmatu Medycyny Opartej na Faktach (ang. Evidence Based Medicine – EBM). Stanowi ona najlepszy obecnie dostępny łącznik pomiędzy badaniami naukowymi a praktyką kliniczną. Z EBM wiąże się nierozerwalnie promocja zabiegów rehabilitacyjnych, których skuteczność została potwierdzona eksperymentami klinicznymi o charakterze prospektywnym, kontrolowanym z randomizacją, grupą kontrolną oraz analizą przypadków, które nie zostały włączone do badań lub „wypadły” z badań w ich trakcie (z różnych przyczyn). Z jednej strony daje to zmniejszenie ryzyka terapii, możliwość standaryzacji terapii i skrócenie czasu potrzebnego na podjęcie decyzji klinicznych, ale z drugiej, przy zbyt sztywnym i proceduralnym podejściu, może powodować: – odejście od metod, które są znane, lecz dotychczas nie sprawdzono wystarczająco ich efektywności (np. wskutek braku wystarczającej liczby pacjentów czy trudności z opracowaniem nowych narzędzi diagnostycznych) – utrącenie inicjatywy i indywidualnego podejścia do pacjenta, szczególnie w trudnych przypadkach. Te wady EBM są łatwe do wyeliminowania, gdyż EBM stanowi tylko jeden (ale nie jedyny i nie główny) element całego procesu decyzyjnego opartego nie tylko na wiedzy

307

i doświadczeniu klinicznym, ale również na zdrowym rozsądku. EBM dostarcza rzeczowych argumentów do dyskusji, ale nie może być wykorzystywane „na ślepo”. Dodatkowo przy wnioskowaniu statystycznym opartym na EBM należy pamiętać o często popełnianych błędach, wynikających m.in. ze zbyt szerokiej ekstrapolacji wyników z badań (w tym prowadzonych na małych próbach) oraz zbytniego zaufania w niepodważalność i ostateczność diagnozy [3]. Zróżnicowanie schorzeń, ich obrazów klinicznych oraz sposobów postępowania utrudnia (a w części przypadków – uniemożliwia) wprowadzenie deterministycznego podejścia do diagnostyki, planowania i realizacji rehabilitacji. Rycina 2 przedstawia jeden z możliwych wariantów, jednak trudno jednoznacznie narzucić jego poprawność i niezmienność w każdym przypadku. Bez względu jednak na to, obiektywizacja wyników rehabilitacji w praktyce klinicznej: 1. wspomaga diagnostykę stanu zdrowia (w tym stanu funkcjonalnego) pacjenta, 2. pozwala wypracować najefektywniejszą strategię terapeutyczną (plan usprawniania), zwiększając szanse pacjenta na powrót do zdrowia (a w części przypadków: tylko do maksymalnej osiągalnej sprawności): – zapewniając rzeczowe argumenty za wyborem konkretnej terapii i jej własności (parametrów), – dając możliwość dopasowania terapii do możliwości danej placówki służby zdrowia (z uwzględnieniem ograniczeń wynikających z wyposażenia, umiejętności personelu itp.) – ucząc poszukiwania, porównywania oraz oceniania rozwiązań alternatywnych, w tym lepszych pod względem np. dostępności, efektywności, czasochłonności, kosztów i innych istotnych w danym przypadku parametrów – zapobiegając pominięciu istotnych rozwiązań lub ich kluczowych elementów.

Przegląd systematyczny randomiz. badań klinicznych Randomizowane badanie kliniczne Kontrolowana próba kliniczna Badania kliniczno-kontrolne

Badania kliniczne klasy I Badania kliniczne istotne, wiarygodne i aktualne i i d Badania kliniczne istotne i wiarygodne

Badania kliniczne klasy II Badania kliniczne klasy III Badania kliniczne klasy IV

Badania kliniczne istotne

Serie pacjentów bez kontroli Opisy przypadków Opinie ekspertów

Badania kliniczne

Badania biomedyczne

Rycina 2. Wybrane hierarchie źródeł zgodnie z paradygmatem EBM [2, 4, 5, 6]. Figure 2. Selected hierarchies of sources according to EBM paradigm [2, 4, 5, 6].

PRACE POGLĄDOWE

308

Emilia Mikołajewska

Ocena dotychczasowego leczenia pacjenta

Ustalenie warunków rodzinnych, środowiskowych, zawodowych oraz socjalnych pacjenta

Weryfikacja i uzupełnienie diagnostyki

Ocena stanu funkcjonalnego pacjenta lub Potwierdzenie dotychczasowego rozpoznania klinicznego

Postawienie nowego rozpoznania

Ustalenie: 1) celu rehabilitacji, 2) hierarchii ważności potrzeb pacjenta, 3) prognozy końcowego stanu funkcjonalnego

Ustalenie programu rehabilitacji (tj. przebiegu indywidualnego procesu usprawniania)

Weryfikacja programu rehabilitacji

Ocena negatywna: wymagane zmiany w programie rehabilitacji

Ustalenie: 1) okresów obiektywizacji, 2) kryteriów oceny, 3) sposobów weryfikacji uzyskiwanej poprawy klinicznej i funkcjonalnej

Cykliczna kontrola efektów oraz trudności realizacji procesu leczniczego

Proces terapeutyczny Ocena pozytywna Ustalenie elementów ciągłego procesu rehabilitacji: 1) potrzeb, 2) warunków, 3) zasad dalszej opieki nad osobą z niepełnosprawnością w warunkach ambulatoryjnych, domowych itp.

Weryfikacja: 1) potrzeb, 2) warunków, 3) zasad oraz wynikającego z nich programu rehabilitacji i opieki

Przygotowanie i edukacja rodziny/opiekunów

Ustalenie: 1) okresów obiektywizacji, 2) kryteriów oceny, 3) sposobów weryfikacji uzyskiwanej poprawy klinicznej i funkcjonalnej

Proces terapeutyczny w warunkach ambulatoryjnych lub domowych

Ocena negatywna: wymagane zmiany

Ocena pozytywna Cykliczna kontrola efektów oraz trudności realizacji procesu opieki ambulatoryjnej lub domowej

Rycina 3. Miejsce obiektywizacji w ramach procesu decyzyjnego i terapeutycznego w rehabilitacji (jeden z możliwych wariantów). Figure 3. Place of objectivization within decision making process and therapy in rehabilitation (a version).

PRACE POGLĄDOWE

Obiektywizacja wyników rehabilitacji – próba ujęcia kompleksowego

3. uczy wnioskowania klinicznego, w tym dzięki: – rozwijaniu myślenia „niesztampowego”, co jest szczególnie istotne w terapii zorientowanej na pacjenta – dyskusjom w ramach zespołu wielodyscyplinarnego z lokalnymi autorytetami klinicznymi i/lub naukowymi 4. umożliwia tworzenie standardów postępowania oraz wytycznych klinicznych ułatwiających podejmowanie decyzji klinicznych, umożliwiających porównywanie i kontynuację rehabilitacji podejmowanej w różnych ośrodkach 5. ułatwia monitorowanie postępów pacjenta i modyfikację terapii, w tym unikanie błędów w sztuce, zaniechań oraz ewentualnych niepożądanych skutków terapii 6. umożliwia nabieranie wiedzy i doświadczenia porównywalnego z doświadczeniem specjalistów medycznych w innych ośrodkach, w tym zagranicznych [2]. Rozwój istniejących sposobów obiektywizacji wyników rehabilitacji oraz poszukiwanie nowych metod tego typu nakłada bardzo wysokie wymagania na przygotowanie kadr medycznych, co jest szczególnie trudne w sytuacji zanikającej relacji mistrz-uczeń. Sposoby obiektywizacji wyników rehabilitacji w praktyce klinicznej Jak przedstawiono powyżej, obiektywizacja wyników rehabilitacji stanowi proces: – ciągły – realizowany cyklicznie w ramach całego procesu diagnostyki, planowania rehabilitacji oraz prowadzenia rehabilitacji – wielopłaszczyznowy – sposób realizacji obiektywizacji zależy od szeregu czynników, takich jak rodzaj schorzenia, wiek pacjenta, poprzednio stosowane metody terapeutyczne, schorzenia towarzyszące, zmiany wtórne, a obiektywizacja może się odbywać jednocześnie na kilku różnych poziomach obserwacji (por. powiązanie geny – białka – neurony – układ nerwowy – zachowanie), różnymi metodami, obejmując całość lub pojedyncze aspekty zdrowia pacjenta, również etapami w miarę postępu terapii – elastyczny – dynamika zmian jest adaptacyjnie dostosowywana do zmian stanu zdrowia pacjenta. Pierwszy i zarazem podstawowy etap obiektywizacji jest realizowany w ramach procesu diagnostycznego. Proces ten pozwala poprowadzić powiązanie pomiędzy obrazem klinicznym problemu zdrowotnego pacjenta (generującym szereg różnych, często wykluczających się hipotez) a szczegółową, sprecyzowaną diagnozą. W rehabilitacji dotyczy on nie tylko weryfikacji stanu pacjenta na podstawie kartoteki, wywiadu oraz niezbędnych badań (w tym: laboratoryjnych, diagnostyki obrazowej i innych stanowiących element obiektywizacji), ale również obiektywizacji diagnostyki funkcjonalnej poprzez wykorzystanie: – badań antropometrycznych

309

– oceny zdolności fizycznej i aktywności poszczególnych grup mięśniowych, propriocepcji, równowagi oraz koordynacji ruchowej – oceny i/lub analizy chodu – skal klinimetrycznych – innych narzędzi (np. elektromiografii – EMG, elektromiografii powierzchniowej – sEMG) według potrzeb. W ramach opisanego procesu decyzyjnego zawiera się również wnioskowanie kliniczne w fizjoterapii [7] obejmujące najczęściej cztery główne etapy: zbieranie danych, tworzenie hipotezy, interpretacja danych i ewaluacja hipotezy. Ważnym elementem jest tu nie tylko korzystanie z ICD, ale również z ICF [8]. Najnowocześniejsze narzędzia informatyczne służące obiektywizacji w obszarze procesu edycyjnego obejmują medyczne systemy ekspertowe oraz systemy tzw. „drugiej opinii”. Trzeba zaznaczyć, że obiektywizacji diagnozy służą również standardy medyczne, wytyczne kliniczne, dyskusje z lokalnymi autorytetami klinicznymi i/lub naukowymi, dyskusje w ramach wielodyscyplinarnego zespołu terapeutycznego oraz oczywiście wykorzystanie EBM. Rezultatem tak postawionego problemu klinicznego jest potwierdzenie dotychczasowego rozpoznania klinicznego lub postawienie nowego rozpoznania. Kolejny etap obiektywizacji realizowany jest w procesie planowania rehabilitacji. Samo planowanie wymaga przede wszystkim określenia celów długoterminowych (w tym funkcjonalnych) oraz składających się na nie celów krótkoterminowych (ang. goal setting), z uwzględnieniem wskazań i przeciwwskazań u konkretnego pacjenta. Niezbędne wydaje się tu nie tylko podparcie się EBM, obowiązującymi standardami terapii oraz wytycznymi klinicznymi, ale również potrzebami i preferencjami pacjenta (ang. patient-oriented therapy). Nowoczesna rehabilitacja prowadzona według zasad Polskiej Szkoły Rehabilitacji kładzie duży nacisk na jej holistyczny charakter zgodny z modelem biopsychospołecznym, w którym jakość życia pacjenta odgrywa bardzo ważną rolę. Nabiera to szczególnego znaczenia w odniesieniu do pacjentów przewlekle chorych, niepełnosprawnych oraz w podeszłym wieku. Obiektywizacja w ramach prowadzenia rehabilitacji wynika z potrzeby ciągłego monitorowania przebiegu terapii i niezwłocznego reagowania na stwierdzone nieprawidłowości. Obejmuje ona: – współpracę z personelem medycznym oraz innymi osobami (rodziną/opiekunami) pozostającymi w najbliższym otoczeniu pacjenta – wykorzystanie narzędzi umożliwiających cykliczną kontrolę efektywności procesu rehabilitacji oraz identyfikację i walidację trudności z nim związanych (w tym możliwości i potrzeb pacjenta) – rozważenie sprawdzonych alternatyw klinicznych dających lepsze rokowanie (dla potrzeb obiektywizacji: większe prawdopodobieństwo sukcesu terapeutycznego w przypadku danego pacjenta)

PRACE POGLĄDOWE

310

Emilia Mikołajewska

– wybór najskuteczniejszego sposobu postępowania, tj. pozostawienie bez zmian lub wprowadzenie zmian do planu rehabilitacji. W obszarze monitorowania przebiegu rehabilitacji wykorzystuje się szereg rozwiązań technicznych przeznaczonych dla konkretnych zastosowań lub schorzeń. Ciekawym rozwiązaniem uzupełniającym w obiektywizacji może być monitorowanie poziomu aktywności fizycznej pacjenta (np. w okresie tygodnia) oraz jego wydatku energetycznego. Niewielkie przenośne urządzenia wykorzystujące akcelerometrię oraz pedometry (umożliwiające pomiar liczby kroków) mogą zapewnić obiektywizację poziomu realizowanej przez pacjentów aktywności fizycznej w sposób niedostępny dla tradycyjnie stosowanych badań kwestionariuszowych [9]. Interesujące jest również zastosowanie posturografii w ocenie stabilności posturalnej, stanowiące, szczególnie u osób w podeszłym wieku, alternatywę dla klinicznych testów oceny stabilności postawy (Funkcjonalna Skala Równowagi Berga, Ocena Mobilności POAM, test Tinnettiego) [10]. Warto nadmienić, że rozwiązania obiektywizujące przebieg rehabilitacji nie muszą być wcale kosztowne – w części przypadków wystarczą najprostsze działania, często również organizacyjne. Podjęto również badania nad obiektywizacją wyników rehabilitacji m.in. w zespołach bólowych kręgosłupa [11, 12] oraz chorobie zwyrodnieniowej stawu biodrowego [13]. Temat ten wciąż jednak wymaga prób całościowego opracowania. Wnioski Obiektywizacja wyników rehabilitacji staje się powoli istotnym elementem postępowania terapeutycznego. Wymaga wiedzy i umiejętności, ale niejednokrotnie ułatwia przyjęcie odpowiedzialności za podejmowane decyzje terapeutyczne, jednocześnie zwiększając efektywność terapii i bezpieczeństwo pacjentów. Prezentowane podejście do obiektywizacji wyników rehabilitacji może stanowić punkt odniesienia dla kolejnych prac z tego zakresu oraz impuls do dyskusji nad omawianym zagadnieniem jako rozwiązaniem systemowym. Cytowane prace z zakresu obiektywizacji ograniczają się z reguły do jednego schorzenia lub grupy schorzeń, brak również metaanaliz lub wytycznych klinicznych mających szersze zastosowanie. Nie ulega wątpliwości, że usystematyzowanie obiektywizacji wyników rehabilitacji może pociągnąć za sobą wzrost jej efektywności, co przełoży się na wyższą ocenę jakości pracy personelu medycznego. Niestety, w przypadku metod obiektywizacji wyników rehabilitacji nasuwają się dwa zasadnicze spostrzeżenia: – nie ma jednego, uniwersalnego narzędzia, a wręcz przeciwnie – tworzone są wciąż nowe, dla określonych, przeważnie wąskich, zastosowań – metody proste i szybkie nie są zbyt dokładne, natomiast metody o wysokiej wiarygodności wymagają drogiego sprzętu, skomplikowanych procedur oraz bywają czasochłonne, stąd ich przydatność w praktyce klinicznej jest ograniczona.

PRACE POGLĄDOWE

Ciekawe pole do dalszej dyskusji daje pogląd wyrażony przez Błaszczyka i Czerwisza [10], że rehabilitacja polegająca na powtarzanym, zaprogramowanym i kontrolowanym ruchu jest zbliżona do treningu. W takim przypadku zalety nowo projektowanych testów wykorzystywanych do obiektywizacji w rehabilitacji mogą być następujące: – opracowanie prostych i szybkich metod obiektywizacji umożliwiających wychwycenie pacjentów wymagających dalszej, bardziej dokładnej (czasochłonnej, kosztownej, itd.) diagnostyki – wprowadzenie dynamicznych zadań o charakterze diagnostycznym [10] – ćwiczenia wchodzące w skład testów mogą skuteczniej oceniać możliwości pacjenta poprzezzwiększenie jego motywacji wywołanej np. za pomocą biofeedbacku z wykorzystaniem rzeczywistości wirtualnej (np. w rezultacie współzawodnictwa z wirtualnym przeciwnikiem) – możliwość jednoznacznej oceny wyników testu – stopnia trudności, dokładności, czasu wykonania itp. – próby automatyzacji, szczególnie na potrzeby systemów telemedycznych, telerehabilitacyjnych i zintegrowanych. Piśmiennictwo 1. PubMed (U.S. National Library of Medicine). 2. http://www.ncbi.nlm.noh.gov/pubmed/ – data pobrania 19.03.2012 r. 3. Mikołajewska E.: Metody obiektywizacji wyników fizjoterapii. Rocznik Naukowy Akademii Wychowania Fizycznego i Sportu w Gdańsku, 2011, XXI, 101-107. 4. Radomski D., Grzanka A.: Metodologia badań naukowych w medycynie. Wydawnictwo Naukowe Uniwersytetu Medycznego w Poznaniu, 2011. 5. Mikołajewska E.: Dominujące trendy we współczesnej rehabilitacji. Niepełnosprawność i Rehabilitacja, 2010, 1, 87-102. 6. Mikołajewska E., Mikołajewski D.: EBM w fizjoterapii – wykorzystanie zasobów internetowych. Rehabilitacja w Praktyce, 2008, 4, 50-52. 7. Mikołajewska E.: Medycyna oparta na faktach w fizjoterapii. Valetudinaria, 2007, 2, 88-91. 8. Kaczmarek D., Łochyński D.: Współczesny model wnioskowania klinicznego w fizjoterapii. Praktyczna Fizjoterapia i Rehabilitacja, 2010, 5, 23-26. 9. Lupa A., Śliwka A.: Badanie pacjenta zgodnie z wytycznymi ICF. Praktyczna Fizjoterapia i Rehabilitacja, 2010, 20, 31-37. 10. Plewa M., Szuta A., Spyt A. i wsp.: Zastosowanie urządzenia ActiGraph (model GT1M) w 7-dniowym pomiarze wydatku energetycznego oraz liczby kroków w przebiegu kuracji odchudzającej. Endokrynologia, Otyłość i Zaburzenia Przemiany Materii, 2008, 5, 1, 1-6. 11. Błaszczyk J. W., Czerwosz L.: Stabilność posturalna w procesie starzenia. Gerontol. Pol., 2005, 13, 1, 25-36. 12. Tryniszewski W., Żytkowski A., Gadzicki M. i wsp.: Próba obiektywizacji efektów fizykoterapii u pacjentów z zespołami bólowymi kręgosłupa w odcinku lędźwiowokrzyżowym. Acta Balneologica, 2010, LII, 3, 151-159.

Obiektywizacja wyników rehabilitacji – próba ujęcia kompleksowego 13. Dwornik M., Kujawa J., Białoszewski D. i wsp.: Elektromiograficzna i kliniczna ocena skuteczności neuromobilizacji u chorych z zespołami bólowymi części lędźwiowokrzyżowej kręgosłupa. Ortopedia Traumatologia Rehabilitacja, 2009, 11, 2, 164-176. 14. Golec J., Rożek K., Kazana M.: Obiektywizacja metod oceny wydolności czynnościowej stawu biodrowego w przebiegu choroby zwyrodnieniowej. Ortopedia Traumatologia Rehabilitacja, 2010, 12, 3, 273-277.

311

Adres do korespondencji: dr Emilia Mikołajewska Klinika Rehabilitacji 10 Wojskowy Szpital Kliniczny z Polikliniką SP ZOZ ul. Powstańców Warszawy 5 85-681 Bydgoszcz

PRACE POGLĄDOWE

REGULAMIN Informacje ogólne 1. „Nowiny Lekarskie” zamieszczają prace oryginalne, poglądowe, kazuistyczne, sprawozdania ze zjazdów i konferencji, recenzje książek oraz opracowania z zakresu historii medycyny. 2. Do pracy należy dołączyć zgodę Kierownika jednostki, z której pochodzi doniesienie oraz imię i nazwisko, adres, numer telefonu (faksu) Autora odpowiedzialnego za korespondencję z Redakcją. 3. W piśmie przewodnim należy zamieścić oświadczenie, że nadesłana praca nie była dotąd nigdzie publikowana, ani też nie została złożona do druku w innym czasopiśmie. 4. Prace podlegają recenzji, przy czym recenzenci nie znają nazwisk autorów, ani też nazwy ośrodka, z którego praca pochodzi. 5. Redakcja zastrzega sobie prawo do dokonywania zmian dotyczących stylistyki, mianownictwa i skrótów – bez uzgodnienia z Autorem. 6. Należy używać międzynarodowych nazw leków (w nawiasie można podać nazwy fabryczne) oraz jednostek w układzie SI (jednocześnie w nawiasie można podać jednostki stare). 7. Prace, których przedmiotem badań jest człowiek, muszą posiadać zgodę Komisji Etyki, co należy zaznaczyć w opisie metodyki. 8. Tekst pracy (wraz z rycinami i tabelami) należy składać na nośniku elektronicznym w programie Microsoft Word 2003 lub starszym wraz z wydrukiem w 3 egzemplarzach. Tekst na nośniku powinien być zapisany w formacie A4, bez adiustacji (tj. wytłuszczeń, podkreśleń, wcięć akapitowych, itp.). W przypadku przysłania kilku prac – każda winna być umieszczona na oddzielnym nośniku. 9. Do tekstu każdej pracy należy dołączyć, na oddzielnych stronach, tytuł, słowa kluczowe i streszczenia – i to zarówno w języku polskim, jak i angielskim. 10. Tabele należy umieścić na oddzielnych stronach. Każda powinna być oznaczona arabską cyfrą i tytułem w języku polskim i języku angielskim, a w tekście trzeba zaznaczyć miejsce jej umieszczenia. 11. Ryciny należy również umieścić na oddzielnych stronach i opatrzyć tytułem w języku polskim i języku angielskim. Ryciny powinny być oznaczone cyframi arabskimi, a w tekście pracy należy zaznaczyć ich miejsce. W razie konieczności ryciny należy podpisać na odwrotnej stronie. Ryciny winny być załączone na nośnikach elektronicznych, tj. dyskietce lub CD-ROM w formacie tif w rozdzielczości minimum 300 dpi. Jeśli nie ma takiej możliwości, ważne jest, by przesłany wydruk był bardzo dobrej jakości. 12. Piśmiennictwo powinno być napisane na oddzielnej stronie – wg kolejności cytowania (a nie w porządku alfabetycznym). Należy podać: kolejny numer pozycji; nazwiska autorów i pierwsze litery imion (w przypadku, gdy jest więcej niż trzech autorów, należy podać trzech pierwszych i dodać: „i wsp.”, tytuł pracy. Następnie: a) tytuł czasopisma z zastosowaniem obowiązujących skrótów (wg Index Medicus), rok, tom, numer strony pierwszej i ostatniej, b) tytuł książki, nazwę i siedzibę wydawnictwa, rok wydania, numer strony pierwszej i ostatniej, c) tytuł rozdziału cytowanej książki, nazwisko/nazwiska i pierwsze litery imion autora/autorów tegoż rozdziału, tytuł książki, nazwisko i imię autora (redaktora) książki, nazwę i siedzibę wydawnictwa, rok wydania, numer pierwszej i ostatniej strony cytowanego rozdziału. Zaleca się, by ilość cytowanych pozycji nie przekraczała 35. Informacje szczegółowe

I. Prace oryginalne – objętość prac nie może przekraczać 15–17 stron, wliczając w to stronę tytułową, streszczenie, tekst właściwy oraz piśmiennictwo – tekst doniesienia składa się z następujących części: • strona tytułowa, która winna zawierać: tytuł pracy, nazwiska i imiona autorów, nazwę instytucji i nazwisko kierownika, z której praca pochodzi • strona druga – streszczenie w języku polskim i języku angielskim zawierające 200–250 słów, które winno mieć charakter strukturalny, a więc zawierać: wstęp, cel pracy, metodykę, wyniki i wnioski • strona trzecia – tytuł oraz słowa kluczowe w języku polskim i angielskim • strona czwarta i następne – pełny tekst pracy podzielony na następujące części: wstęp, materiał i metody, wyniki, dyskusja, wnioski, piśmiennictwo.

II. Prace kazuistyczne – objętość prac kazuistycznych nie powinna przekraczać 3–4 stron, wliczając w to stronę tytułową, słowa kluczowe, streszczenie oraz piśmiennictwo.

III. Prace poglądowe – objętość prac poglądowych nie powinna przekraczać 15–20 stron.

IV. Sprawozdania ze zjazdów i recenzje – objętość sprawozdań i recenzji nie powinna przekraczać 2 stron.

INSTRUCTIONS TO AUTHORS General 1. Nowiny Lekarskie (Medical News) publish original papers, reviews, case descriptions, reports from meetings and conferences, book reviews and papers on history of medicine. 2. The manuscript should be supplemented by consent of the head of the unit from which the report originates, and by name, surname, address and telephone (fax) number of the author responsible for correspondence with the Editorial Office. 3. The papers should be accompanied by a declaration of the authors that the submitted paper has not been published previously or submitted to other journals. 4. The papers undergo a review and the reviewers do not know the authors or the name of the center from which the paper originates. 5. The Editors reserve for themselves the right to introduce changes in the manuscript related to its style, nomenclature and abbreviations without consultation with the authors. 6. International names of drugs should be used (in brackets company’s name may be added) and units should follow the SI system (in brackets old units may be added). 7. Studies conducted on humans should receive first the consent of Ethical Commission, which should be declared in the Methods. 8. The text should be submitted, together with figures and tables, on a floppy disc using the Microsoft Word 2003 or older program, with its printout in 3 copies. On the floppy disc the text should be written in A4 format, without editorial preparation (i.e., without specification of bold type, underlining, indentations, etc.). When several papers are submitted in parallel, each of them should be recorded on a separate floppy disc. 9. Every paper should be supplemented by the title, key words and an abstract in Polish and in English, on separate sheets/pages. 10. Tables should be submitted on separate sheets/pages. Each should be marked by an Arabic numeral and a title in Polish and in English. In the text, the location of the table should be marked. 11. Also figures should be submitted on separate sheets/pages and supplied with a title in Polish and in English. The figures should be numbered with Arabic numerals and their position in the text should be marked. If needed, the figures may be signed on the reverse side. Figures should be submitted in an electronic form, i.e. on a floppy disc or CD-ROM in tif format with a minimum of 300 dpi. If they cannot be submitted in such a form, it is important that the submitted print is of a very high quality. 12. References should be submitted on a separate sheet/page, in the order in which they appear in the text (not in alphabetical order). The reference number should be followed by names and initials of authors (if there are more than three authors, the first three should be followed by “et al.”) and title of the paper should be given. Subsequently: a) the journal title should be specified using the Index Medicus abbreviations, year of publication, volume, numbers of the first and the last page or b) title of the book, editor, year of publication should be followed by numbers of the first and the last page or c) title of the chapter of cited book should be given, with surname/surnames and initials of the author(s) of the chapter, title of the book with the surname and name of its author(s)/editor(s), name and site of the editor, year of publication. numbers of the first and the last page of the cited chapter. Recommended amount of cited references should be limited to 35. Detailed informations

I. Original papers – the size of a paper cannot exceed 15–17 pages, including the title page, summary, the proper text and references – the text should include: • title page with the title of the paper, surnames and names of authors, name of the institution from which the paper originates and name of the head of the institution • the second page with abstracts in Polish and in English, each containing 200–250 words and consisting of introduction, the aim of study, methods, results and conclusions • the third page containing the title and key words in Polish and in English • the fourth and the following pages containing the full text of the paper divided into introduction, material and methods, results, discussion, conclusions and references.

II.

Case descriptions – their volume should not exceed 3–4 pages, including the title page, key words, summary and references.

III. Reviews – their volume should not exceed 15–20 pages.

IV. Reports from meetings and conferences – volume of reports and book reviews should not exceed 2 pages.

NOWINY LEKARSKIE – LISTA RECENZENTÓW dr hab. Wiesław Bryl prof. dr hab. Jaromir Budzianowski dr hab. Maria Chrzanowska prof. UM prof. dr hab. Jerzy Głuszek prof. dr hab. Sylwia Grodecka-Gazdecka prof. dr hab. Ryszard Koczorowski dr hab. Jacek Koźlik prof. UM dr hab. Anita Magowska prof. dr hab. Przemysław Majewski dr hab. Ryszard Marciniak prof. UM dr hab. Jerzy T. Marcinkowski dr hab. Grzegorz Mielcarz prof. UM prof. dr hab. Andrzej Obrębowski dr hab. Maciej Owecki

prof. dr hab. Juliusz Przysławski prof. dr hab. Marek Spaczyński prof. dr hab. Andrzej Szkaradkiewicz dr hab. Jacek Szmeja prof. UM prof. dr hab. Teresa Torlińska prof. dr hab. Joanna Twarowska-Hauser prof. dr hab. Andrzej Tykarski prof. dr hab. Jarosław Walkowiak dr hab. Jerzy G. Wójtowicz prof. dr hab. Henryk Wysocki prof. dr hab. Lucjusz Zaprutko dr hab. Katarzyna Ziemnicka prof. UM prof. dr hab. Dorota Zozulińska-Ziółkiewicz

View more...

Comments

Copyright © 2017 SLIDEX Inc.
SUPPORT SLIDEX